Strain Name: rspo2 / Allele: TSP |
|
| Allele | TSP |
| Strain Name | rspo2 |
| Type | Mutant |
| Genotype | |
| Affected Gene | r-spondin2 |
| Origin and Depositor | Tohoku University (Tohru Suzuki ) |
| Link to ZFIN | ZDB-ALT-150311-5 |
| Information | |
| Mutant shows abnormalities in skeletal system, mainly in neural/hemal arches. Gill opercle formation is affected. Mutants can be identified by PCR amplifying the mutation region under folllowing condition: primers, AGTGGGCCAGTGGAGTGA and CCCCACTTGAAACCACAGGT; genomic DNA as template, anneal at 58°C; amplicon size is 66 bp for wild-type and 59 bp for mutant. |
| The Conditions to Distribute Strains | |
|
In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Tatsumi et al., (2014). TALEN-mediated mutagenesis in zebrafish reveals a role for r-spondin 2 in fin ray and vertebral development. FEBS Lett. 588:4543-4550. |
| Request |
|
| Reference | |
|
|
| Facility | RIKEN Center for Brain Science |