Strain Name: wnt8a / Allele: ORF1ORF2-1/+ |
|
| Allele | ORF1ORF2-1/+ |
| Strain Name | wnt8a |
| Type | Mutant |
| Genotype | |
| Affected Gene | |
| Origin and Depositor | Nagoya University (Masahiko Hibi) |
| Link to ZFIN |
| Information | |
|
Deletion mutantions are introduced in both ORF1 and ORF2 of wnt8a gene (-16 bp in ORF1, -9+5 in ORF2) by TALENs. The ORF1 mutation can be detected by PCR with the primers:ORF1-T1-short-F, CAGAGTGGTATAGAAGAGTGCA; ORF1-T1-short-R, CGCTTTCCGGGCAGTTCCACCT. The ORF2 mutation can be detected by PCR with the primers: ORF2-T2-short-F, TGGCATGTCAGAAAGTTGCACA ; ORF2-T2-short-R, AGTCAGCCAGTTGCATCCAGCA . Zygotic homozygous mutant embryos show dorsalized and anteriorized phenotypes. |
| The Conditions to Distribute Strains | |
|
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. The recipient and the DEPOSITOR shall sign an MTA, which set forth the terms and conditions to use the intellectual property rights based on the results of research using the BIOLOGICAL RESOURCE and so on. The recipient shall be sent an agreement for distribution obtained from the DEPOSITOR to NZC. |
| Request |
|
| Reference | |
| Facility | RIKEN Center for Brain Science |
