Top | About the KOMUGI | Related Sites | Update | SiteMap | Contact Us
Quick Search   for   
  Strains ( NBRP / Others ) Genes / Marker cDNA TAC Map Comparative Map BLAST
  DNA Seq. Organelles Chromosomes Microarray eWIS Tools Story of wheat (Japanese only) Textpresso(TEST)
 Japanese | English

  BLAST
  Tissue specific clones
  complex contig list
Query Form

  How to use Virtual Display(2012)

  Related Sites
  Download
  How to Order Resources

  MTA Sample


• >
/images/estsTitleEn2.gif
Fasta Format
Accession CJ637687
Length 477 bp
Fasta Format >whec10f14
tgatggatcgggggtcagagattgcggggcagctgaaaaagcatgccccg gaaatcttgggcagcatctgcaatgaggctatcttccagatgaagatacc attcatcggcagcaaagaaagccagttcgagttgaaggactactggttta acgaccccaacaagtcactaagcaggctanagcanagggcgaggcgtgcg ttggccatgcgagagaaggaccggattcgacgtgaggagttcaaacgtgc tgaggcggaaaggaaacgtgcggctgcgcctctgtacgagcagtacatgg ccaggaaggatttgaatggtatgaaggtgatggagcagctacgcgaggag aggatgaggcggttgtcggggaatatgtaggacaggacacgtagacagca gccggtctgataagctgtgcggtcgtgggtgatggacccggttttgacac tgttggcaattgctgccaaaaaaaaaa
Download
 
NBRP MacGene Copyright © 2012 NBRP-Wheat. All rights reserved.