Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs2k17
Contig Information
Length 727 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs2k17   
Homology (BLAST) Top Hit RHM1 [Zea mays]
Score 834
Evalue 1.61212e-87
Total Hit Count 121
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs2k17
GATTTTAGATCTGTTCTCATAGATAACCAGGCCAGCAAACATATCCACCACTACATAGAACATCTGATAATACTCAAGTGAAACATAACGCGTAACAAAA
AATGGTAAATATGTATGCATGCTATACCACAATAAAATTGACCACAGCTGCCACCGTGCAATATATTAGCTAATTAGAAATAGCTTATAGCAGACCTGTG
TCACATGAATCCTCAATTAGTAGACACCTTCCTGTTTGGCTCAAAGACATTCCTGATCAAAGATTCCTTAATGGACAGTAGCTCAGGGAACTCGGACTTC
AGCTTTGACGCGTCCATTTCGTTGTTGCTTCTTGGTGCAACTATAACCTTGGCCTGCTCTTCGAGCGTGAAGTTGGTCCACTTGAAGTCCGGGTTTATGT
ATTCCTTGTACATCTCCAGAATCTCGTTGTGACTGACAACCCCTGGGTTGGTGAAATTCCATATGCCCCTACAATCCCGCTTCGCCATCTCAACAGAGAT
AGGCAACAATTCATCCAAAATTGTCATACTGTTCGGAATGTTCACCACCTTGTCATAGCGGGCTATTTTTGTGATGAAGTTACGAGGATTGCTCAGGTCT
GATGATATGGGCATCCTGACTCTAAGAGTACAGACATTATCATAGTCCTTCAATAACTCTTCCACCATGGCTTTGGTTTTGGAATAAAATGAACCTACAA
AGTTGGGCGTGTCCTCCTCTTTAAAAC
page-top