Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

whcs10p04
Contig Information
Length 687 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs10p04   
Homology (BLAST) Top Hit unknown [Oryza sativa (indica cultivar-group)]
Score 440
Evalue 7.01734e-42
Total Hit Count 69
Registered year 2003
Contig Sequence     [ Download ]
>whcs10p04
CTCCTGCTCCCCTCAAGTCCCCGTAGCTAGCCAGTGTTGCTGTTCTCGCGCGGCGTCGGCGGCAGCCATGGAGGAGGTGACGGAGGCGGTGAACAACCTT
ACCATAGCGGAAGGAGCGGCGGCGACGGCGGGAGCGGAGGGGCACAAGAAGAACCGCATCCAGGTCTCCAACACCAAGAAGCCCCTCTTCTTCTACGTCA
ACCTCGCCAAGAGGTACATGCAGCTGCACGAAGAGGTGGAGCTCTCGGCCCTCGGCATGGCTATTGCAACTGTGGTGACTGTTGCGGAAATTCTAAAAAA
TAACGGCCTTGCTGTTGAGAAGAAAATAATGACATCTACTGTTGATGTCAAAGATGATACAAGGAACCGGCCTATCCAGAAGGCCAAGATCGAAATATTG
ATTGGCAAGACGGAGAAATTCGATGAACTGATGGCTGCCGCTGCAGAGGAGAGGGAGGCAGCGGGTGCCGAGGAAGAGCAAAGCTGAACACTTGGAAGGT
TCCTGTTGTAGCTTAATTTTACTGTTCTTCTGCCCTTTGCTGTGTTTTAGTTTGTTGTGTCGACAAGAGACAAGTGCTTGCATAATCAAGCAAGGGCGCA
GCTTATTTTAGTGCGCTTTTTGTTGATTTGTTAGGGTTACATGGCAACTTGTGATAATGGGATTATGAGTATGATACAAAAAAAAAA
page-top