Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs3g01
Contig Information
Length 718 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs3g01   
Homology (BLAST) Top Hit hypothetical protein OsJ_007753 [Oryza sativa (japonica cultivar-group)]
Score 466
Evalue 7.43817e-45
Total Hit Count 487
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs3g01
ACGTTTTTTCGTTTTCCCTATCTGTAATCCTCCTGTGTACTGTGTACATATCCGACAGATGCACCAACCTCGACCGAGAAAACTATCTTGAGGATGCCAT
GCATCGATGGACTGGACTCATTCGATCGGAACCCATAACCTACTGCATGCTGGAAGAGTACTGCAGCGGCGACGACGACCGGCGGCGCCTCTTCTTGGAC
TCCCCCCAGAGGTGGAAGCTGGAGTCGCCGTCGGCGAGGTCGTCACACTCGGGGAAGACCGTGGTCTTGTATCGCACCCGGTCGCGGCAAGCCGTGTAGG
TCAGGTACTGCTCGCGGAACCCCCTCATGGCGGCGCGCTTGGCAGGGGCCATGACGGCGACGTCGTGCGTGAGCAGGTCGACCTGGCACCCCTCGGGGTC
GGCGACGCTGCTGGCGTCGCAGCCGCTCAGGACGAGGTCGGAGAACTCGGCGGCGAATGGCGCGTAGGCGTAGTCGACCTTGTACTTGCCGCCATCGGTG
GCCCAGGCGGAGCCGTCCCANATGGTGGCGTANACGGACATGGGCTTGGAGGGGAAGTCGCCGCCCATGGAGGGAACGCCNACCACCTCNCGGATGGGGA
CNCCGTCNAGGTANAANACNATGTTGTTGGGGGTCCANGCTATGGCATANCNNNGGACNCCNNNNANNNTANGTTCNACNNNNANATNNNAANNNTCCTN
TCNNNNNNNNNNNNNNNT
page-top