Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

whcs10o15
Contig Information
Length 819 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs10o15   
Homology (BLAST) Top Hit Os02g0832500 [Oryza sativa (japonica cultivar-group)] >gi|32483423|gb|AAP84973.1| callose synthase-like protein [Oryza sativa (japonica cultivar-group)] >gi|113538159|dbj|BAF10542.1| Os02g0832500 [Oryza sativa (japonica cultivar-group)]
Score 1372
Evalue 8.32264e-150
Total Hit Count 272
Registered year 2003
Contig Sequence     [ Download ]
>whcs10o15
CACGCTGCGTGAAGGAAACGTTACACATCATGAATACATGCAAGTTGGCAAGGGAAGAGATGTTGGTCTCAACCAGATTTCACTATTCGAGGCAAAAATT
GCGTATGGTAATGGCGAACAGACACTGAGCCGTGACATCTACCGACTTGGGCATCGTTTTGATTTCTTCAGAATGTTGTCCTGCTACTACACTACTATTG
GCTTCTACTTCAGCACAATGATTACGGTATGGACCGTGTATGTATTTCTCTATGGGCGTCTGTATCTTGTCCTCAGTGGGCTTGATAAAGGACTAGCCAC
TGGAAGAAGGTTTATACACAATGACCCTCTCCAAGTCGCTCTCGCTTCGCAATCTTTTGTTCAGCTTGGCTTCTTGATGGCGCTCCCTATGATGATGGAG
ATCGGTCTGGAGAGAGGGTTCAGGACCGCGTTGAGCGACTTTGTGCTCATGCAGCTTCAGTTAGCGTCCGTCTTCTTCACATTCTCCCTCGGAACCAAGA
CTCACTACTACGGAAAGACGCTGCTCCACGGAGGAGCCGAGTACAGAGCCACCGGACGTGGATTCGTGGTGTTCCATGCCAAATTCGCCGAGAACTATCG
ACTGTACTCACGGAGCCATTTCGTCAAGGGCATCGAGCTGATGATCCTGCTTATCGTGTTTGAGATCTTCGGGCAGTCGTACCGAGGAGCTATCGCGTAC
ATCTTCATCACCTTCTCCATGTGGTTCATGGTTGTCACCTGGCTCTTTGCGCCGTTCCTGTTCAACCCTTCTGGGTTCNAGTGGCANAANATTGTGGACN
ACTGGACCGACTGGAACAA
page-top