Top | About the KOMUGI | Related Sites | Update | SiteMap | Contact Us
Quick Search   for   
  Strains ( NBRP / Others ) Genes / Marker cDNA TAC Map Comparative Map BLAST
  DNA Seq. Organelles Chromosomes Microarray eWIS Tools Story of wheat (Japanese only) Textpresso(TEST)
 Japanese | English

  BLAST
  Tissue specific clones
  complex contig list
Query Form

  How to use Virtual Display(2012)

  Related Sites
  Download
  How to Order Resources

  MTA Sample


• > Contig Detail
/images/estsTitleEn2.gif
cDNA - Contig Detail
whcs10o15
Contig Information
Length 819 bp
Tissue Callus
Clones
whcs10o15   
Homology (BLAST) Top Hit Os02g0832500 [Oryza sativa (japonica cultivar-group)] >gi|32483423|gb|AAP84973.1| callose synthase-like protein [Oryza sativa (japonica cultivar-group)] >gi|113538159|dbj|BAF10542.1| Os02g0832500 [Oryza sativa (japonica cultivar-group)]
Score 1372
Evalue 8.32264e-150
Total Hit Count 272

Contig Sequence     [ Download ]
>whcs10o15
CACGCTGCGTGAAGGAAACGTTACACATCATGAATACATGCAAGTTGGCA
AGGGAAGAGATGTTGGTCTCAACCAGATTTCACTATTCGAGGCAAAAATT
GCGTATGGTAATGGCGAACAGACACTGAGCCGTGACATCTACCGACTTGG
GCATCGTTTTGATTTCTTCAGAATGTTGTCCTGCTACTACACTACTATTG
GCTTCTACTTCAGCACAATGATTACGGTATGGACCGTGTATGTATTTCTC
TATGGGCGTCTGTATCTTGTCCTCAGTGGGCTTGATAAAGGACTAGCCAC
TGGAAGAAGGTTTATACACAATGACCCTCTCCAAGTCGCTCTCGCTTCGC
AATCTTTTGTTCAGCTTGGCTTCTTGATGGCGCTCCCTATGATGATGGAG
ATCGGTCTGGAGAGAGGGTTCAGGACCGCGTTGAGCGACTTTGTGCTCAT
GCAGCTTCAGTTAGCGTCCGTCTTCTTCACATTCTCCCTCGGAACCAAGA
CTCACTACTACGGAAAGACGCTGCTCCACGGAGGAGCCGAGTACAGAGCC
ACCGGACGTGGATTCGTGGTGTTCCATGCCAAATTCGCCGAGAACTATCG
ACTGTACTCACGGAGCCATTTCGTCAAGGGCATCGAGCTGATGATCCTGC
TTATCGTGTTTGAGATCTTCGGGCAGTCGTACCGAGGAGCTATCGCGTAC
ATCTTCATCACCTTCTCCATGTGGTTCATGGTTGTCACCTGGCTCTTTGC
GCCGTTCCTGTTCAACCCTTCTGGGTTCNAGTGGCANAANATTGTGGACN
ACTGGACCGACTGGAACAA
 
NBRP MacGene Copyright © 2012 NBRP-Wheat. All rights reserved.