Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs2l14
Contig Information
Length 721 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs2l14   
Homology (BLAST) Top Hit polyprotein [Oryza australiensis]
Score 160
Evalue 4.1714e-21
Total Hit Count 374
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs2l14
TACTACTCTTAGCAACTGAACCAGTATCAAATACCGAGGGGTTGCTATAAACACTAGTAAAGTACACATCAATAACATGTATATCAAATATAGCTTTGTT
CACTTTGCCATCCTTCTTATCCACCAAATACTTTGGGCAGTTCCGCTTCCAGTGACCAGTCCCTTTGCAGTAGAAGCACTCAGTTTCAGGCTTAGGTCTA
GACTTGGGCTTTTTCACTTAAGCAGCAACTTGCTTGCCGTTCTTCTTGAAGTTCCCCTTTCTTCCCCTTGTCCCTTTACTTGAAACTAGTGGTCTTGTTA
ACCATCAACACTTGATGCTCTTTCTTGATTTCTATCTTCGTCGATTTTAGCATCGCGAAGAGCTCGGGAATTACTTTCATCATCCCTTGCATATTATAGT
TCATCACGAAGTTCTAGTAACTTGGTGATAGTGACTAGAGAATTCTGTCAATTACTATCTTATCTGGAAGATTAACTCCCACTTGATTCAAGCAATTGTT
GTACCCAGACAATCTGAGCACATGCTCACTGGTTGAGCTATTCTCCTGGTCCTGGATGGAGATCAGGCCAGAAATATCACAACTCAAAGTGGCAGTTCAT
AGTTGATTAAAGCAGCAACAACAACCTAAAACATAATAGTAGTACTCCTTGGATGATCACTGATGTGCACATGCTAACCCTCTTGGATGATCTACTCGTA
TCACAGAGCCTCAGTCCAGTA
page-top