Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

whcs10n13
Contig Information
Length 108 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs10n13   
Homology (BLAST) Top Hit hypothetical protein OsJ_016056 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 1252
Evalue 6.84e-136
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whcs10n13
CGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGACACTCTCTCCCCC
CCCCCCNC
page-top