Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs2m10
Contig Information
Length 615 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs2m10   
Homology (BLAST) Top Hit hypothetical protein OsJ_016056 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 1252
Evalue 6.84e-136
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs2m10
TTCCAATTCTTACNAATATAGAGGTAACCCNACTTTCACATGCTTAGACTCTTTGACAGCCATGCAACTACATGGCAATTTCTGGTGTGTCGTCAGACCT
GTGACATGGGAGTAAAGAGGTAAAGAGAAAGGAGCACTTACCAGAGATTTATCATGGGCTGACTATTGCTGCTACCATAGGATTATTTGGCCCCACCTTT
GCAGCTATCTCATCTCACGCTGTTCGTTGACACTGAAGAAGGGAAGATTCCGAATCAAATCAATTCCCTTACTATCAATCGCACTTGCTGCAATTTTTTC
TGAGTACTTCATCTCGCTACGTTGGACGATGCAGCTTCACTCAAGGTCTTTCTCCTGCTGCTCCGGTGGGCAACCCTCCCTCAACCGTTGACCCCGCCCG
TATTAGACGCTCCACCAACCCCTGCTGCTGCTTCTAGAGGCGCAAGATTCGCCATGGCCTTCTTTCCCGGCCCAGACGAGGGAGGTTCGTGCGACGGTGG
CTGACAAGGGAGTGAGGATGGAGGAGGAGGGAGTGGACCGGCAGCTGTGGTGCCAAGGACGGAGGAAGCACGAAGCAGGGATGGANGCAGAGGCAGCGCC
TCCTATGGNGCANAG
page-top