Top | About the KOMUGI | Related Sites | Update | SiteMap | Contact Us
Quick Search   for   
  Strains ( NBRP / Others ) Genes / Marker cDNA TAC Map Comparative Map BLAST
  DNA Seq. Organelles Chromosomes Microarray eWIS Tools Story of wheat (Japanese only) Textpresso(TEST)
 Japanese | English

  BLAST
  Tissue specific clones
  complex contig list
Query Form

  How to use Virtual Display(2012)

  Related Sites
  Download
  How to Order Resources

  MTA Sample


• > Contig Detail
/images/estsTitleEn2.gif
cDNA - Contig Detail
rwhcs14g03
Contig Information
Length 531 bp
Tissue Callus
Clones
rwhcs14g03   
Homology (BLAST) Top Hit PREDICTED: similar to nuclear factor related to kappaB binding protein, [Monodelphis domestica]
Score 87
Evalue 0.312348
Total Hit Count 21

Contig Sequence     [ Download ]
>rwhcs14g03
AAAGCATCTACGATCGAAAAGGCAAGGCCTCCTGCCTGGGAGCCTCCTAA
CTACTCTTGGTCGTCGGCGTCCGTCACGTGGTAGTAGGCACCCTCGGGGT
AGCAGCCGTCGTCAAAGGTGGCATCTGGCTCCTGGACTCCACCATCTGGT
TGCTCTGGCAAGGAGGGGTCGTTGTCGACGTAGTCGATCACAAGGGCGGC
ATCGGTCTCGGGGTAGCGAAGCTCGTGAAGGGCTTGACGAAGCCGGAGGG
GTCGAGGGAGAGCGGATCGACGGCGAGGTCGTGGCGGCTGTGCGTGGGGA
GGAACCCGATGGCGAGCGCTGGCGGTGGCCTGGAGACGAGCCGAGGGGCG
TAGAGGAAGGAGACGACGACGGCGGACCGCCTGGACGCCATGGCGTAGCT
CGGGGTGGCCGGTTGCCGCGGAATCGATGAGGGCACGGCGACGACCGCCG
GGATTCGCGTTGGGGAGAAGACAGTGGCGCGAGGGAGCTCTCTCTCTCTC
TCTCTCTCTCTCTCTCTCTCTNTNTNNNTNT
 
NBRP MacGene Copyright © 2012 NBRP-Wheat. All rights reserved.