Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs14g03
Contig Information
Length 531 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs14g03   
Homology (BLAST) Top Hit PREDICTED: similar to nuclear factor related to kappaB binding protein, [Monodelphis domestica]
Score 87
Evalue 0.312348
Total Hit Count 21
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs14g03
AAAGCATCTACGATCGAAAAGGCAAGGCCTCCTGCCTGGGAGCCTCCTAACTACTCTTGGTCGTCGGCGTCCGTCACGTGGTAGTAGGCACCCTCGGGGT
AGCAGCCGTCGTCAAAGGTGGCATCTGGCTCCTGGACTCCACCATCTGGTTGCTCTGGCAAGGAGGGGTCGTTGTCGACGTAGTCGATCACAAGGGCGGC
ATCGGTCTCGGGGTAGCGAAGCTCGTGAAGGGCTTGACGAAGCCGGAGGGGTCGAGGGAGAGCGGATCGACGGCGAGGTCGTGGCGGCTGTGCGTGGGGA
GGAACCCGATGGCGAGCGCTGGCGGTGGCCTGGAGACGAGCCGAGGGGCGTAGAGGAAGGAGACGACGACGGCGGACCGCCTGGACGCCATGGCGTAGCT
CGGGGTGGCCGGTTGCCGCGGAATCGATGAGGGCACGGCGACGACCGCCGGGATTCGCGTTGGGGAGAAGACAGTGGCGCGAGGGAGCTCTCTCTCTCTC
TCTCTCTCTCTCTCTCTCTCTNTNTNNNTNT
page-top