Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs2m11
Contig Information
Length 737 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs2m11   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 475
Evalue 7.10129e-46
Total Hit Count 124
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs2m11
ATCCGGTTATGGAGCCCAATTCAACAACAAACTATGTAACTATGGTGTATTTCCCAGTGGTGGGTGAGATTAATCACAAGCCATTACGCCACCTGACAGT
TGGGGCCTGGCAATATATCCAGTTGTAAAAGGAAACATCAGAATGATTCTCTAGGTAGTAAGCCTGCGTGTACATGTCTGAGCTACTATCTGAACTCACC
GGAAACAGTATACAGGAGGAGAGGCCATGATGCATTGCTGTATGAGTGATAATTGCTCCCTGAATCAAGACGCTGTGCAGCTCGCGACTCTGATGAAGAA
CAGTTTCTTCTGAAGATTGGGCATAACGCCCACTGCAGTAGCAACTCAGCCACAATGCGATCTATTAGTGCTACCAATTGGAAGGTGGCCGTGTAGACTA
GCCCTTGTGTTATATGGGCTCATTTGTACTACAACTTGAACTCACAAAAGCAATGTTCAGGGAGAGCTAATCCCCTCCCCATGATATAATCCTCTCGGTG
AGCATCCCACATGGCCTTAGCTAGTTGGTCCCCTGCCAGTCCAGCAGCCGTGTAGTTTGCGAAGGCCCTCCTACTCAAGACCAATGTCTTCTGCAGCCCT
TGCATTGTTCTCATTGCAGTTACCATCTTATCCATATTTCCAAAGAATGTGGTAACATAAGCATCGCTGTTGACTGAAACATAGTAGTCGAGAGCAGCTT
TTGTGTTGCCATGCATCCTCTCAAATCTTCATGAGTC
page-top