Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs4b21
Contig Information
Length 926 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs4b21   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 703
Evalue 3.89689e-72
Total Hit Count 283
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs4b21
GCGCGCATTCATAAACCAAATATCCTGAATCCGTTGCTGATCACTGTTTTATACCCTACATAAGACTAAAGTGATGCGAACCGTTCCACATCGCAAAAGA
AAACAGTTTGAACTCTTCGACACAGAACAATTTTAGATTCCCTAGTAAAAACCATATGCAAGTATAGACATGTAAAACCCCAACTCAGTCTCAGATGGTA
TCCCTAGGTGTGGCTGAATCTTTTCCCCTAATCAGTAATCTGCTCTATAAATAAGGCTTCTTGCTTGCTTGTTAACCCGAGATCAGTAAATGATTGGTCG
CCGTCAGCAGTGGTAAAAGCACGCCTGGGGTATGTCCTTACCAGTCTGTAGGTTTCTGGCTTGCAAGTCCTGCCAACGTCTAAGAAATCAAAAAGGGACT
TGAATTTATCAGATTTTAAAAAGCGACGCCCCTGTCGACTACCGTCAGGCATGCGAACTACAAGTGTTATAACACCTTCCTTGTCTGAAGGTGGCTCCAA
TGGCAATGATGCTTCTTTGGCGGCAAGATTGGACTCAAGCTCCTCTTTCTCAAGTTGCATTTTACGCTGTTCCTCCTCCTCTTGCCTTTGTTTCTCAAGA
GCAGCTTCTCTTGCAGCAGTTTCTTCCAGCAGTCTGAGCTCAGCTTCTTGTAGAGTCTTCATCTCCTTTTCTTGATCAGCTTGGAGCGATGCAAGGTACT
CATCATCCTGCTGCTCTCGTAATAACCGTTGTTCAGTCAATTCTGGTGGTGGAGAGTGCACTACTTGGGGATAATGACTCGAGCTCGCATGAGATAATGG
ATATGTTGGTGCTTCAGGAATTCCACCAAACATTGCAGCCTCAAGCATAACAGCTTCATCATGTTCCTCAGAAGAAATGCCACCCCACTCTGGATGGGAA
ATCAGTTCTGTTATACTGGCGATCAT
page-top