Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

whcs10l16
Contig Information
Length 803 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs10l16   
Homology (BLAST) Top Hit hypothetical protein OsI_33252 [Oryza sativa Indica Group]
Score 836
Evalue 1.14052e-87
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whcs10l16
GCAGTCTCCAGCTTCGTGAGTGAGGGAGAGAAAGAAGGAGAAGGATGCTAGAGATGAAGCCCTGCAGAGCCATAGCTCTGGTGCTCGTTGTAGCAGCACA
ATGCGCCGCCCTGGCCACCGCCGCCGGTCCGAGAGTCATCATCGTCGGCGCCGGCATGTCCGGGATCTCGGCTGGGAAGAGGCTGTCCGAGGCCGGGATC
ACCGACTTGCTGATCCTGGAGGCGACGGACCGCATCGGCGGGCGCATCCACAAGACCAAGTTCGCCGGGGTGAACGTTGAGATGGGGGCCAACTGGGTGG
AAGGGGTGAATGGAGATGAGATGAACCCCATCTGGACCATGGCCAATGGCACCGGAGGCCTCAACCTCAGGACCTTCCGCTCCGACTTTGACCACCTCGC
CAGCAACACCTACAAGCAAGACGGTGGTCTCTATGACGAGAAAGTTGTTGAGAATATAATCGAGAGGATGGATGAAGTGGAGGAGAGCGGGAGCAAGCTC
TCCGGCACCTTGCACCACAGCGGCCAACAGGACATGTCTGTCATGGCCATGCAACGCCTCAACGACCATATGCCTTCGGGCCCCGCGAGGCCGGTGGACA
TGGTGATCGACTACTACCANCACGACTTCNAGTTCGCCGAGCCACCCCGCGTGACNAGCCTGCANAACACGCANCCGCTGCCGACGTTCANCAACTTCNG
CNACNACGTCTATTTCNTGGCGGACCANCGGGGGTACNANTCCNTGGTGTACCATGTCNCCNGNCANTACCTCAANACCGACCNCAANTCCNGCNCCATC
NTC
page-top