Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs4b20
Contig Information
Length 365 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs4b20   
Homology (BLAST) Top Hit hypothetical protein TRIADDRAFT_54260 [Trichoplax adhaerens] >gi|190586302|gb|EDV26355.1| hypothetical protein TRIADDRAFT_54260 [Trichoplax adhaerens]
Score 78
Evalue 2.67611
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs4b20
GATGTTTTCAATGATGCATCAAAAGAGGAACTTTTGGTGGCTGCTCTGCTCTAATAACAATGAAATATCAATACTAATTAGAGAAGGGAGAGGAACTTAC
GATGGCTGTTGTGCATCAAATGTGCTGATGCAACACTTGTTTTCGTCTTACCTAGGGACTTGTCCCATTGGTCGCCGTCCAGCAGCANATGTTAGCACCA
CCGGGGCTCCAACCCAGCGTTGTTCAAACAATAATTCGGAAATGAATTTATGAANAGTTATAACCCATCTANCCTATCATAACTATTTAATAGGTTCANT
TTCTATTCCTGTCAAATCTGAATATAANTACCNCNCCNNNTACCTANTTCNTGATGTGTATCNNG
page-top