Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

whcs13j10
Contig Information
Length 689 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs13j10   
Homology (BLAST) Top Hit hypothetical protein OsI_19839 [Oryza sativa Indica Group]
Score 962
Evalue 2.50992e-108
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whcs13j10
ATTGCTGGCTGTCGGTGCTGATCCTACAGCACAAGATGACCCACATTGCCGAACTGCGATTGCATACTGCAGCAATGATCAACGATGCAGAATTGGTAAA
GATTATCCTCGATGCTGGAGTTGATGTAAATATAAGAAATGCTCAAAACACAACACCACTTCATGTTGCACTGAACAGAGGTGCAAACTCATGTGTTGGC
TTGCTTTTANCTGCTGGGGCAGACTGTAATCTACAGGATGACGACGGTGATAATTCTTTTCACATAGCTGCTGATGCATCCAAAATGATTCGGGAAAACC
TGACTTGGGTTGTTCAAATGCTGGAACATCCATCACCTGCTGTTGATGTGAGGAACCACAGAGGTTGGACACTGCGAGATTTTCTTGAGAGGCTCCCACG
AGAATGGATTTCTGAAGAACTGATGGAGAAACTTGAAGATAAAGGAGTTCATCTCTCTCCAACCATATATGAGGTTGCGGATTGGGTTAAATTTANAAGA
ACAGTTACTTCTCCGGATTTTGGCTGGCAAGGTGCTGGACCCNAAAGCATTGGCTTTGTCCAGTCTATTGTAGACAATGACCACCTTATTGTGTCATTTT
GCTCTGGAGAAGCTCGTGTTTTGACCAGTGAAGTTATCAAGGTCATTCCATTGAATAGGGGCCAGCATGTGCAGCTCAAAGCTGATATT
page-top