Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs2m21
Contig Information
Length 320 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs2m21   
Homology (BLAST) Top Hit protein phosphatase 2C isoform epsilon [Zea mays]
Score 493
Evalue 2.06654e-48
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs2m21
CGATATCNTCAACTTTCACATCAGGCTCTGATTTCNAAAGTGATTTTAGATTCCTGTCCCCAAACGCTCTGGACACGGCCAACTGACCACAGACTCTGGG
AACATCTCCTGGCATATTTGAAACAAAACCACCCTTGTTTTCAATAGCTCCACGCTCTGCATTCGGGTCGTGGTCAATTGACATCTGTATGGCCTCACCT
CCTTTCAGAAGAACAGCCCGCGAATCCCCAACATTAGCTACCCACAACTTACTGCCATTTATAAGGATGGCAGTTACGGCAGTGGAGCCACCTTGTCCCA
AATCTGGAGTATGTGACANA
page-top