Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs14g15
Contig Information
Length 780 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs14g15   
Homology (BLAST) Top Hit hypothetical protein OsI_20152 [Oryza sativa Indica Group]
Score 685
Evalue 3.50997e-70
Total Hit Count 12
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs14g15
GGNAGAGGTATTGCTAAGCACTTAATTACATACATCCTCAACCCAAGAAATTAGCATTCTTGCTATCAAAGCAAAACCGGGCTAGGCAGCTCATCAACGC
GCCCTCCAACTACCTACCTAATCTAGATACAGACAGGCACTTGGGTTTAAGCAGCATCTAGCCCTTGTGTTTTCCTGTGTAAAACAGACAGTTTCAATCA
TGTGAATTAGCTATCACCTCTCTAAGCTACATCTCTCCCTTCTCTGTTTGCTGAGAGAGATGTCGATCGGCGTAGTGGAGAAGTCTCCTCAACCTCAGAA
CCATATCACAGTGGAAGGGGAGAGCGCTGCGCCTTTCCGTGTAGACCGGGCTTACCGTCATCCACGAAAGGGCGTGGAGCTCAGCGGCCACCGCCTCCAA
CACATTGTGCATGTCCATTTCGTAATCACGGGCTGATGTTTCATGGGTGTTGTTCCTTGCCTGCTTGCTCATGCTGCTGCCGCCAACGCCTCTGCTCATC
TTCTCTTGGACAGTGGCGGTGCTGCCTCCGTAGNAATCGATGATGCTGACAGAGAGAACGGAGTGCCTGTCCTCCTTGGTGAGTTGCGCGGCATCCTTTC
TTACTGGTGGGACAGCTTTGGAGACGACATAACCCATTGCCAAGGGAGTTGCTGTCCCTTTGCTGTGCAATAGGTGGGCAAGCGGCGGGGATTCCGATGT
AAGGCACGTTGGAAGCTGTAATGTCGCAAGGGAAAGATACCGCATACTTGGTGACGGAACCNNAAGATACGATGCAGACA
page-top