Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

whcs10k21
Contig Information
Length 810 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs10k21   
Homology (BLAST) Top Hit hypothetical protein OsI_09692 [Oryza sativa Indica Group]
Score 404
Evalue 1.44538e-37
Total Hit Count 262
Registered year 2003
Contig Sequence     [ Download ]
>whcs10k21
TCTAAGCAGAGGGGCAGAGCAGGCCGCGCCGCTGTCGTCTCCCACTCTCCGTCGCCGTCACCGTTGCCCTCTCCTCCTCATCTGCCTCCGCCCTCTCCAG
TGCTCGCCTCCTCCTCCGCCGTCGCCGTCGCCGTTGCGGTCTCCTCCGCGGCTCCGCCTCCGCCCTTCCTCGTGTGCTTGCCTGCTCCTTGGCCGTCGCC
CTCTCCTCCGTGGCTCAACCTCCGTTCTTCCTCGTGCTCCCCCTCGCCCTCTTTACCGCAGAGAGAGAGAGAGAGAAAGAGAGGGTCAGAGGCGGCGCGT
CTACTCAGATCAACAATGGTGGACTGGACTAGCGATAACGATGATAGTGATAAGTTTGAGTGGGAAAGTGATGGTGAGGCTGAACCCTCATCGGCTCCGG
CCTTCAGGAACTTGGATGCCGCTGGTCCTTCCACGCTGGATTCTAATGGGTGGGCCAACGAGGAAGCACCACCCACTTCGTTAGTCGAGGGATATGTGTT
AATGGGTTTCCCGAAAGAGATGGTCTTGAAGGGAATTAAGGAGATTGGGCACAGTGATGCAAATGCATTGCTGGAACTACTTCTCACATATAAGACACTG
GGTGATGATGCTGCAGCGGGTAATTGCTCTACTTCTGGTTGCTTCCCCCAGAGTGTTGAAGATGATGATGATTTTGATTTTGAAAACTGGGATGGAGACG
ATGATGCTGATGGGAGAGAGCCCAACCCTGATAGTTCTGGTGATGANGATTTCCTAANAGAGATGTCANAGAAGGACAACAAGATCAAGTCCTTANTANA
CATGGGCTTT
page-top