Top | About the KOMUGI | Related Sites | Update | SiteMap | Contact Us
Quick Search   for   
  Strains ( NBRP / Others ) Genes / Marker cDNA TAC Map Comparative Map BLAST
  DNA Seq. Organelles Chromosomes Microarray eWIS Tools Story of wheat (Japanese only) Textpresso(TEST)
 Japanese | English

  BLAST
  Tissue specific clones
  complex contig list
Query Form

  How to use Virtual Display(2012)

  Related Sites
  Download
  How to Order Resources

  MTA Sample


• > Contig Detail
/images/estsTitleEn2.gif
cDNA - Contig Detail
whcs10k21
Contig Information
Length 810 bp
Tissue Callus
Clones
whcs10k21   
Homology (BLAST) Top Hit hypothetical protein OsI_09692 [Oryza sativa Indica Group]
Score 404
Evalue 1.44538e-37
Total Hit Count 262

Contig Sequence     [ Download ]
>whcs10k21
TCTAAGCAGAGGGGCAGAGCAGGCCGCGCCGCTGTCGTCTCCCACTCTCC
GTCGCCGTCACCGTTGCCCTCTCCTCCTCATCTGCCTCCGCCCTCTCCAG
TGCTCGCCTCCTCCTCCGCCGTCGCCGTCGCCGTTGCGGTCTCCTCCGCG
GCTCCGCCTCCGCCCTTCCTCGTGTGCTTGCCTGCTCCTTGGCCGTCGCC
CTCTCCTCCGTGGCTCAACCTCCGTTCTTCCTCGTGCTCCCCCTCGCCCT
CTTTACCGCAGAGAGAGAGAGAGAGAAAGAGAGGGTCAGAGGCGGCGCGT
CTACTCAGATCAACAATGGTGGACTGGACTAGCGATAACGATGATAGTGA
TAAGTTTGAGTGGGAAAGTGATGGTGAGGCTGAACCCTCATCGGCTCCGG
CCTTCAGGAACTTGGATGCCGCTGGTCCTTCCACGCTGGATTCTAATGGG
TGGGCCAACGAGGAAGCACCACCCACTTCGTTAGTCGAGGGATATGTGTT
AATGGGTTTCCCGAAAGAGATGGTCTTGAAGGGAATTAAGGAGATTGGGC
ACAGTGATGCAAATGCATTGCTGGAACTACTTCTCACATATAAGACACTG
GGTGATGATGCTGCAGCGGGTAATTGCTCTACTTCTGGTTGCTTCCCCCA
GAGTGTTGAAGATGATGATGATTTTGATTTTGAAAACTGGGATGGAGACG
ATGATGCTGATGGGAGAGAGCCCAACCCTGATAGTTCTGGTGATGANGAT
TTCCTAANAGAGATGTCANAGAAGGACAACAAGATCAAGTCCTTANTANA
CATGGGCTTT
 
NBRP MacGene Copyright © 2012 NBRP-Wheat. All rights reserved.