Top | About the KOMUGI | Related Sites | Update | SiteMap | Contact Us
Quick Search   for   
  Strains ( NBRP / Others ) Genes / Marker cDNA TAC Map Comparative Map BLAST
  DNA Seq. Organelles Chromosomes Microarray eWIS Tools Story of wheat (Japanese only) Textpresso(TEST)
 Japanese | English

  BLAST
  Tissue specific clones
  complex contig list
Query Form

  How to use Virtual Display(2012)

  Related Sites
  Download
  How to Order Resources

  MTA Sample


• > Contig Detail
/images/estsTitleEn2.gif
cDNA - Contig Detail
whcs13i19
Contig Information
Length 503 bp
Tissue Callus
Clones
whcs13i19   
Homology (BLAST) Top Hit Os07g0192700 [Oryza sativa (japonica cultivar-group)] >gi|50510117|dbj|BAD30885.1| AAA-type ATPase-like [Oryza sativa Japonica Group] >gi|113610637|dbj|BAF21015.1| Os07g0192700 [Oryza sativa (japonica cultivar-group)] >gi|125557550|gb|EAZ03086.1| hypothetical protein OsI_25230 [Oryza sativa Indica Group]
Score 265
Evalue 6.03427e-22
Total Hit Count 80

Contig Sequence     [ Download ]
>whcs13i19
GCTGGACCACTTCCGGTCGTCGGCGTGGTACTACCTGACGGCGGTGCTGG
CGGCGTGCGCCCGCATCGGGGTGTTCCGGACCTACTTCAACCAGTACCTC
CGGCGGCCCCTGCGGCGGCTGCTCCCGTTCCTGGACCCGTTCNTCACCAT
CGACATCGCGGCCAAACCGGAGGACTACTCCTTCTCGTACCANGGCAAGG
TGAAGTCGAGCGACGCGTACGCGGAGGTGCTGGCGTACCTGAGCGCGGTG
TGCTCGCGGGACGCGCGGGAGCTGCGCGCGGAGGGCGCCGTCGAGGGCCA
CACCTTCGTGCTCAACCTCCGGGAGGGGCAGGTGGTGACGGACGACTTCA
AGGGCGCCACCATATCGTGGTCGGCGGTGGCGGAGGAGAAGACGACGTGG
CGGGCGTCNGGGCGGTGCTGCCGCCTCACGNTCCACTAGCGNCACCGGNG
GTTCGTCGTCGACTAGTACCTGNCACACATCNNCNGNGCCGGGNAGGANG
TNA
 
NBRP MacGene Copyright © 2012 NBRP-Wheat. All rights reserved.