Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

whcs13i19
Contig Information
Length 503 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs13i19   
Homology (BLAST) Top Hit Os07g0192700 [Oryza sativa (japonica cultivar-group)] >gi|50510117|dbj|BAD30885.1| AAA-type ATPase-like [Oryza sativa Japonica Group] >gi|113610637|dbj|BAF21015.1| Os07g0192700 [Oryza sativa (japonica cultivar-group)] >gi|125557550|gb|EAZ03086.1| hypothetical protein OsI_25230 [Oryza sativa Indica Group]
Score 265
Evalue 6.03427e-22
Total Hit Count 80
Registered year 2003
Contig Sequence     [ Download ]
>whcs13i19
GCTGGACCACTTCCGGTCGTCGGCGTGGTACTACCTGACGGCGGTGCTGGCGGCGTGCGCCCGCATCGGGGTGTTCCGGACCTACTTCAACCAGTACCTC
CGGCGGCCCCTGCGGCGGCTGCTCCCGTTCCTGGACCCGTTCNTCACCATCGACATCGCGGCCAAACCGGAGGACTACTCCTTCTCGTACCANGGCAAGG
TGAAGTCGAGCGACGCGTACGCGGAGGTGCTGGCGTACCTGAGCGCGGTGTGCTCGCGGGACGCGCGGGAGCTGCGCGCGGAGGGCGCCGTCGAGGGCCA
CACCTTCGTGCTCAACCTCCGGGAGGGGCAGGTGGTGACGGACGACTTCAAGGGCGCCACCATATCGTGGTCGGCGGTGGCGGAGGAGAAGACGACGTGG
CGGGCGTCNGGGCGGTGCTGCCGCCTCACGNTCCACTAGCGNCACCGGNGGTTCGTCGTCGACTAGTACCTGNCACACATCNNCNGNGCCGGGNAGGANG
TNA
page-top