Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs2m22
Contig Information
Length 114 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs2m22   
Homology (BLAST) Top Hit MIKC-type MADS-box transcription factor WM22B [Triticum aestivum] (no hit)
Score 680
Evalue 1.05517e-69
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs2m22
CAAACACAGAGCAACCTCCCGAGTCAGCGGGAGCTGGCGGCAGGCATCAAGGCCACATCACGTCCACCNATATCCTGGACACGGCGGAGAGATCCTCCAN
GTCCAACGACGACG
page-top