Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

whcs10k12
Contig Information
Length 858 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs10k12   
Homology (BLAST) Top Hit hypothetical protein OsI_10095 [Oryza sativa Indica Group]
Score 658
Evalue 5.65095e-67
Total Hit Count 80
Registered year 2003
Contig Sequence     [ Download ]
>whcs10k12
TGAGCGAGTGGGATGAATATACTAGATATGTAAATCAAGATGGAGTGGAGGTTACCCCAGCAGTATATGGAGATATTTATGGATATGGGTATGCTCCTTA
TGGCGCCTACTCTCCAGCTAGTTCCCCAGTCCCAACAGTTGATGGTCAGATGTTTGCTGCACAACATTACCAGTATCCAGCTTATTATCAGCCTCCTACC
CCGATTTCTTCTACAACTCAAGGTGACCAGCAGCATTCAGCCAATGCTGATAATAAGCCAGCAGCTAAGGCAGATGCTGCCAAAACAACCACAAATGTTG
TTCCTAATGGTACTGCTCAGAGTAACAGCGGAACTGCTCCCCTTGGGTCAAGCTACCAGAATTCATCACTGACCCCTGATGGAACCTATAGGGCACCCTT
GATAGGTGGAGTCCCTTCTACTGGTTACGTGGACTCAACCTATGGGTATGACACCACAGGGGCACACTATGCTTGGTATGATGGTTCTGCCTATACCAAT
GCACAGCAAAGACCAACTACAGCTAATTACACGCCGTCTTCAGCGTATAATAGCAATGGCTCTTCTGCAAGGTATCAGACCAAGAGCCCCACACCGCAGC
AGACGGGCAACAGGAGACCAACGACTACAACAGGGTCAGCTACTCCTACATACCCAAACAGGATGTACTCGAGCACCCAGTCTTACAACCAGTACGGAAA
TTCGGTCAAAACTGGTCTTATGTATGGAAACACTGGCTACGGAAGCACTGGCTACGGAAGCACTGGCTATGGAAGCAGCGGCTATGGCGGCAGTGGCTAC
GGAAGCAATGGCTATGATTCCAGGTTATATGGNTCGGTGGGGTGTTTCTATGGATAGC
page-top