Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs2n10
Contig Information
Length 510 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs2n10   
Homology (BLAST) Top Hit rust resistance gene ABC1041 [Hordeum vulgare subsp. vulgare] >gi|94410822|gb|ABF18544.1| serine/threonine kinase-like protein ABC1041 [Hordeum vulgare subsp. vulgare]
Score 415
Evalue 2.61273e-39
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs2n10
AATTTGTGGTATAAATTTTATTTTGTGCCAATTGGACCACCCTGACATAAAATCCTGGCTACGCCACTAACTACCACCCTAGCTAGCTAACAGGCTCAGA
CTAAGGCGTCGCTACGACGAGTAGGCCGACGGCTTTGGGTCTCGGCCAGGCTCCTTCAGAAGGTCTCCCGAGCTTTTGCGGCGACCTTTGCCGCTGTTGC
TTGCGCCGGGCGCCGTTTTGCTTCCACTCTTGGGGTCTTGAGGCCTCTCTGCAGCCGGTCTTCTGGTTGGATCTGCCGGTCTTCTGGTTGGGTCGCTGGA
GTCTTGTATCCCTTCCAGAATAGAGACCACGGCGTCCATGGACGGCCTCATCTTAGCTTCGAAGGACAGGCACTCGACAGCCAGTGCAGCGATTGTCTGG
GCTCCGTTCAGGGAGTACTGGCCTTCTAGCCTGGTATCAAGGACACGGAAAATCTTGCGCTTGTGTGTGAGATATGGCTCTCTCTCTCTCTCTCTCTCTC
TCTCTCTNTC
page-top