Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs4b17
Contig Information
Length 848 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs4b17   
Homology (BLAST) Top Hit hypothetical protein OsI_13596 [Oryza sativa Indica Group]
Score 364
Evalue 6.83458e-33
Total Hit Count 11
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs4b17
CGCCGGGCCGTTTTCTCCGGCGACGACAGCCATCGGCGCGTCATTTGGCACCGCCGGACAAGGCGGTGCACGGGGGCCCGGACACCGTCTCAGTTCAGAA
GCACATTCCTGCCCTGTTTGCCAAATGACATGGACACAACACGTCCCGTCCCTGCACCCCACCCCAAAATACACTACTTCACACGAAGTTAACTCCTACA
TAATACCCTCCTAACTCCTCGCTACATCATCAGTATGACCACATTACTCCTCAAGTCACCGAGCAACTCCACTTTTTTCCTTAGGGGCGAGTCGGTGCGC
GAGCGAGCGGCTACTTGAGTGAGCGACACCGAATCCTTTTCAGCTCTGAGACCGGCGCGGAAGATCCTCCGGCATGCTTCCGGATGGCTCCGACGCAAAG
AGGCCTTTTAGGACCCGAGCCGTAGCCGGCATGCAATCTCTTGTATTCGTTCAGCTTTATGAACTGATGAGTCATGGACCACTGCTCGATTTGGTGTAGC
GCTGCCGCGTAGTCTTGGAAGCTGGGCATATTCTCGATTCTTGACAAGGAGCTTTGTAGCCCGCCAAGCCTCACATCGAAGGTTTCCAGAACTTCAGATA
AGAGTTTACGGTCCTCCTTTCCGGAGGTGCTTGTCTCGTTCGGTGGCATGTTTTCACTTTGCATGAAGTTGTTGGTGTCGCTGACAAAAGATTGAACTGG
GTCAGACATATCACTGAGCACCAGTTTACAAATGTGGTACACAATGGCTTCACCGCAATCAGCAACTTTTGCTGCAAGAAGTCTCGCTGACAGAGCAGGA
AGGAGACACTGAATCAAGCTGGTCGTTAAAGTAAGTCTTCTCTGAGCT
page-top