Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs3j09
Contig Information
Length 665 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs3j09   
Homology (BLAST) Top Hit glutamine synthetase isoform GSr1 [Triticum aestivum]
Score 605
Evalue 4.79893e-61
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs3j09
ACGAGTAAAGTGAAAGACACCAAAGGCACGCCCCAAAAACAGACTAGACCTTGCAAAAGAAATGGAAACACGAAACGTTTTGCAGAAATTAATCAATCGC
CACCCTCGATCGAGAGAGTCGAGAGCCTGGGTGTCATGATCTGGCGGCGGTAGGCATGGCCGTGGGTGGGTGGCTCAGAGGAGGAGCGTGGTCTCGGCGA
TCATGGAGGTGACGACGTAGGGGTCCATGTTGGAGGCCGGCCTGCGGTCCTCGAAGTAGCCCTTGCCGTCCTTCTCGGTGTCGCGGCCCACGCGGACGGA
CGCGCCGCGGTCCGCCACGCCCCACTTGAAGGTGTTGATGTCGGCGGTCTCGTGGTGGCCCGTGAGGCGGCGCTCGTTGCCCTCGCCGTANGCGGCGATG
TGCTGCGCGTGCCGCTTGCCCAGCTTCTCNATGGCCGTCTTGATCACCTCNTACCCNCCGGCCTCCCNCATCNACTTGGTGCTGTANTTGGTGTGCNCNC
CCNCNCCNTTCCANTCNCCCNGGATCNNCTTCNNGTCNANGNACNNNACCACCCCNNNAACCTCANTGATCCTCTCNANGATNTANCNCNCCNNCCACNN
NTNNTNNNANNCCNNNATCCCNANNNANNNNCNNNNTTNNAANTNNCNNTNNNNNNNNNTNANNT
page-top