Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs2o03
Contig Information
Length 329 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs2o03   
Homology (BLAST) Top Hit hypothetical protein OsI_19745 [Oryza sativa Indica Group]
Score 299
Evalue 6.39706e-26
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs2o03
CGGAGCAAACTAGGATCATTCACCTANTGGGAAAAGACAGGTCCTTTTCGGGNANCATTCCTTCTGGANACAATGTGTGTCANAGGGGGGAACCAANAAA
CCGCTNCAAGNAAATCTTACTTTGCTTGANGATGCNAGGNAATGAANTCNACTGCCGACTTGATGGAATCGATCTTCTCTGCCTCATTGTCGGGGATCTC
GAAGCTGAATTCTTCCTCAAAGGCCATGACGATCTCTACAGTGTCCANGCTGTCCAGCCCGAGGNCCTTCTGGAAATGCGCATTAGGGGTCACCTTGGAG
GGCTCGATCTTCTGGAANTTCTTGATNAC
page-top