Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

whcs10i11
Contig Information
Length 114 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs10i11   
Homology (BLAST) Top Hit hypothetical protein OsI_13294 [Oryza sativa Indica Group]
Score 153
Evalue 5.51221e-09
Total Hit Count 22
Registered year 2003
Contig Sequence     [ Download ]
>whcs10i11
CCACAACCCTTTCAAGCCGTGGCCGTTCCCGACCANCCTCGGGGACTGCCAATCGATCACCAACTTCTCCGCNAACAGCGTCAACATGACCGGGACGCTC
CCGGACTTCTTCGG
page-top