Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

whcs13i13
Contig Information
Length 809 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs13i13   
Homology (BLAST) Top Hit respiratory burst oxidase-like protein F2 [Hordeum vulgare subsp. vulgare]
Score 1414
Evalue 1.09801e-154
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whcs13i13
ACCTTATCCTGGATTGGTACAAAAGAACGACATGGATGTATCTTGCAGTCCCTGTTGGGTTATATGTAGGGGAGAGGACTCTGAGGTTCTTCAGGTCTGG
CAGTTACTCTGTCCGGATATTGAAGGTGGCCATATATCCTGGTAATGTTTTGACATTGCAAATGTCTAAGCCACCGACATTCCGTTACAAGAGCGGGCAG
TATATGTTTGTTCAATGTCCAGCTGTTTCACCATTTGAATGGCATCCCTTCTCGATAACTTCAGCACCGGGGGATGATTTTCTCAGTATCCATGTCCGAC
AACTTGGTGACTGGACGCGAGAGCTCAAGCGTGTATTCTCCGCAGCTTGTGAGCCACCTATGAATGGGAAAAGTGGCCTCCTTAGAGCAGATGAGAACAC
CAAAAAAACTTTCCCAAAACTTTTGATTGATGGACCGTATGGTTCTCCTGCGCAAGACTATAGCAAGTATGATGTTTTACTACTTGTTGGGTTAGGAATT
GGTGCAACTCCTTTCATCAGCATATTGAAAGATCTGATTAACAACATCATCAAAATGGAGGAAGAGGATGAAGCCTCAACTGATCTTTACCCACCAATCG
GACCCAGTAAGGCATCTGTTGACCTTGACACCCTTATGAGGATTACGTCAAAACCAAAGAGGGTTTTTAAGACAACAAATGCTTACTTTTATTGGGTGAC
ACGGGAACAAGGCTCTTTTGATTGGTTTAAAGGAATCATGAATGAGATTGCTGAACTANATCAAAGGAATATCATTGAGATGCACAACTATCTCACAAGT
GTTTACNAA
page-top