Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs3j24
Contig Information
Length 381 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs3j24   
Homology (BLAST) Top Hit hypothetical protein OsI_22605 [Oryza sativa Indica Group]
Score 579
Evalue 2.18457e-58
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs3j24
CTCACAACTGGGTATTCCGGGAAACGCAACGGCTGACCGATGACATTGAACAGTGTCGCTCGGTTTCCTGAACCTTTGAAAGGTGTTTTGCCGAACAGAA
GCTCATATAAGAATATACCAAAGGTCCACCAGTCAACAGCACTGCCATGGCCCTCACCTTTGATAATCTCAGGGGCCAAGTACTCGTGTGTGCCAACAAA
TGACATTGATCGAGCATCACTAGGTTCTGCCATGAGCTCCGGCCATGGGCGGACCTGGTTGACAACTTCAGGCTTTGGCTTTCNATCTTTCTTCNACTTC
NANAANAACCGAGGGCCAAAGCATGTTGTGGGGGCTGTGCACNATGGCTGTATCATGCANGATGGCTCTGCACAANCTGGT
page-top