Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs4b02
Contig Information
Length 899 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs4b02   
Homology (BLAST) Top Hit RecName: Full=Pectate lyase; Short=PL; Flags: Precursor >gi|623540|gb|AAB46399.1| pectate lyase >gi|1246871|gb|AAA93535.1| pectate lyase
Score 85
Evalue 1.69374
Total Hit Count 12
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs4b02
TTCCCGTGGTACAACATAACAACATCAGCCAACCAGAAGTGCCAAATACAGAAATAAATGTATGCCAACCAACATGACGTGACATAATTAGAGCCAGCAG
AGAAACCAGACACTGTTGTAGACCATCCGAAGCTACGCCTCCATAGCCAAAGATCACTCCTATGAGCATCGATATTGGCCAGGGGCAGGGCCATCACCAC
ACAACGCTGCAAACCCTTTTGCTTTAGTGAAGCAGGGAGGCTGACATGGAGGCCGAGGAAGCCATAGAGGCAGTTATAGATGACGTCGTGTATGTCGATC
GTCCACTCAACCTCCGTCTCCACCAACACCTCTTGCAATGACTCTTTCCTCATCCATGCACACAATCGAATCCATGGAGGAGAGAAGACCAAGGTGAGAT
GGGCTCGGGACCATCCTAAAGAAAATGGAGGTTGGAGGGTTTGATACCTCGGAGGCCAAATGTGCCTCAATGGCAGCTCCACCCTCATCAGCATGGTCAC
GAAAACAAAGATAATTGCCCGCACATCTTATTGCCACCTTTATTGTGCCTCATACCTAGCTGAAGTTCCTGAACAACGCTTCCATCTCATTCATCGACAC
TTGATTTAATTTTAGAAAAAGAAACCACGGTGGGAGGGGCAGGCCTTCGGTGAGCTTCACAGGAGCAGGGTAGCAGACTGCTGTCATCAGTGGTGGATCT
CAATCTGAATCCATGGTCGACGACGGCATTGTTCCTCGAATTTAGTGTGCTCCAACCACTGGCCACACACACTGCTGACCAAACCCCGCAACCTGGTCAA
TCTGGCAGGATTGGTCATGCCCGAGGAGGTCGTGGATGCTGCAACTGGCTCTGCTCTGACGCCCCACCTTCTCCAACTCCACCCTCACAAGAATTGAAT
page-top