Top | About the KOMUGI | Related Sites | Update | SiteMap | Contact Us
Quick Search   for   
  Strains ( NBRP / Others ) Genes / Marker cDNA TAC Map Comparative Map BLAST
  DNA Seq. Organelles Chromosomes Microarray eWIS Tools Story of wheat (Japanese only) Textpresso(TEST)
 Japanese | English

  BLAST
  Tissue specific clones
  complex contig list
Query Form

  How to use Virtual Display(2012)

  Related Sites
  Download
  How to Order Resources

  MTA Sample


• > Contig Detail
/images/estsTitleEn2.gif
cDNA - Contig Detail
rwhcs4b02
Contig Information
Length 899 bp
Tissue Callus
Clones
rwhcs4b02   
Homology (BLAST) Top Hit RecName: Full=Pectate lyase; Short=PL; Flags: Precursor >gi|623540|gb|AAB46399.1| pectate lyase >gi|1246871|gb|AAA93535.1| pectate lyase
Score 85
Evalue 1.69374
Total Hit Count 12

Contig Sequence     [ Download ]
>rwhcs4b02
TTCCCGTGGTACAACATAACAACATCAGCCAACCAGAAGTGCCAAATACA
GAAATAAATGTATGCCAACCAACATGACGTGACATAATTAGAGCCAGCAG
AGAAACCAGACACTGTTGTAGACCATCCGAAGCTACGCCTCCATAGCCAA
AGATCACTCCTATGAGCATCGATATTGGCCAGGGGCAGGGCCATCACCAC
ACAACGCTGCAAACCCTTTTGCTTTAGTGAAGCAGGGAGGCTGACATGGA
GGCCGAGGAAGCCATAGAGGCAGTTATAGATGACGTCGTGTATGTCGATC
GTCCACTCAACCTCCGTCTCCACCAACACCTCTTGCAATGACTCTTTCCT
CATCCATGCACACAATCGAATCCATGGAGGAGAGAAGACCAAGGTGAGAT
GGGCTCGGGACCATCCTAAAGAAAATGGAGGTTGGAGGGTTTGATACCTC
GGAGGCCAAATGTGCCTCAATGGCAGCTCCACCCTCATCAGCATGGTCAC
GAAAACAAAGATAATTGCCCGCACATCTTATTGCCACCTTTATTGTGCCT
CATACCTAGCTGAAGTTCCTGAACAACGCTTCCATCTCATTCATCGACAC
TTGATTTAATTTTAGAAAAAGAAACCACGGTGGGAGGGGCAGGCCTTCGG
TGAGCTTCACAGGAGCAGGGTAGCAGACTGCTGTCATCAGTGGTGGATCT
CAATCTGAATCCATGGTCGACGACGGCATTGTTCCTCGAATTTAGTGTGC
TCCAACCACTGGCCACACACACTGCTGACCAAACCCCGCAACCTGGTCAA
TCTGGCAGGATTGGTCATGCCCGAGGAGGTCGTGGATGCTGCAACTGGCT
CTGCTCTGACGCCCCACCTTCTCCAACTCCACCCTCACAAGAATTGAAT
 
NBRP MacGene Copyright © 2012 NBRP-Wheat. All rights reserved.