Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs3k20
Contig Information
Length 882 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs3k20   
Homology (BLAST) Top Hit Os10g0131000 [Oryza sativa (japonica cultivar-group)] >gi|113638709|dbj|BAF26014.1| Os10g0131000 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 814
Evalue 4.17756e-85
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs3k20
TCTGATTCTTTGTTTCTGGAAGAGAACTATAAATTGGACATCATTGACACCAGCAGCGAAAGGGTGGCTCACCATTCTCCAGCAATGTCTCCATTATGTG
AATATCCTGTAGCGATGTAGAGATATGGAGACTAAACACACTGCCTCAGGCCGCTTCAAATATGATTCCCATGATGAGAGCTCCCTATGCTTGCCATTTG
ATCATAAAGCCTAAGTTTGAAATGATCAGCGCCATTGATGTTCGAGTCCTATAGCACCTTGCAATCCCTCAAATATTTTGTTGTATCTCGTATCCTAATT
ATGCTATGTGACTTATCCAAATAGCATGGCGTGATAAGCTTGTAGAGTGCACGCTTATTCTATCTCATTCCACTACATCTTCGACTTACCTGGCCACCGT
GGTAGCTCCTCTCTCTCCTCTCTTTTGCTGCTCAATATTCTGATCAATCATACAAATACCTAGCGCTTTGTATTATGGCAGGTTAGCACTTTATAAGACA
GTCGAAACTACAGAATGACACCCAGGTGACCCAGCCTTGCTCGCATTTGTGCACGCTTCTATTACCAATTGAATAAAAGCCAAATTGTCGACCGCCTTTA
CTGAAACATGCCACTACTTCTGCAAATACTTTCGCTGCATATATACTGATGGGACCATCTCAGGCACCTGTCGTCTAGAGCGTCATGATGGAGACAACGT
CAGAGAGGAGGAATGTCAATAATACTCAAGCAACAAGTACTTGTATTATGTTGTACAGCTATCAGTATACAAAGTTATGTTTTCTCTGTTCTTAACACAA
TTACGCGAAGAAAAAGAACAGGCCTAACTTCTATGCATGTGGGTGTGCGGATAAACTAACCAAATCATAATATGTATTTTTA
page-top