Top | About the KOMUGI | Related Sites | Update | SiteMap | Contact Us
Quick Search   for   
  Strains ( NBRP / Others ) Genes / Marker cDNA TAC Map Comparative Map BLAST
  DNA Seq. Organelles Chromosomes Microarray eWIS Tools Story of wheat (Japanese only) Textpresso(TEST)
 Japanese | English

  BLAST
  Tissue specific clones
  complex contig list
Query Form

  How to use Virtual Display(2012)

  Related Sites
  Download
  How to Order Resources

  MTA Sample


• > Contig Detail
/images/estsTitleEn2.gif
cDNA - Contig Detail
rwhcs2o23
Contig Information
Length 757 bp
Tissue Callus
Clones
rwhcs2o23   
Homology (BLAST) Top Hit Os08g0127700 [Oryza sativa (japonica cultivar-group)] >gi|75136283|sp|Q6ZK48|SLU7_ORYSJ RecName: Full=Pre-mRNA-splicing factor SLU7 >gi|150417959|sp|A2YQU8|SLU7_ORYSI RecName: Full=Pre-mRNA-splicing factor SLU7 >gi|42407714|dbj|BAD08862.1| putative step II splicing factor SLU7 [Oryza sativa Japonica Group] >gi|113622874|dbj|BAF22819.1| Os08g0127700 [Oryza sativa (japonica cultivar-group)] >gi|215708746|dbj|BAG94015.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765271|dbj|BAG86968.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215768211|dbj|BAH00440.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218200420|gb|EEC82847.1| hypothetical protein OsI_27673 [Oryza sativa Indica Group]
Score 640
Evalue 5.47935e-65
Total Hit Count 147

Contig Sequence     [ Download ]
>rwhcs2o23
GTATGCCATGGGTTACCAGGGAAGGAGGTTACAAAGAACATATGAGAACA
AACTTCGTTCTGCCTTTGGACATCAAGCGATCATATCTGTACTTCACAAC
ATCAGTAACTCACGAGCTGGCATGCCATCCCATCCCGTCTTCCTAGACAC
CCAGAGAATACAGACACAACAATCCGGCAAAGGATGGACAGGCAGCAGAA
GGAGTTCAGGCATAGGCCACGCAACCAGGGGACATGAAAGCCTAATTGAG
AAAATCTTTCATAGGATCGTCGTGGCGGACTCTTGTCATACGGTAGGCCT
CCATGTCTTCCGCAGTGACCTCGTCATTCCACTTCACATTGTACTTTCTC
TTTCTTTCGTCCATCTCTTCCTTCTTCCTCTTTGCCTCCTTCTTTAAGGA
TTCCTCAAGCAACTTCTGGTCGAGAACAAGATCCTGAGGAATATCTGTTC
CCCAAGTGGCTAGTTTCTTTTCTTCTTGTCGTACAGGTTCCTCTTCGGCA
GCCTCCTTGCGGGCCATATTTTCCCTCATCAAATCAGCTGATGCTTCAGC
AGCCTCGATTCCAGCAAGGCCTGTGCAATAACTATTTTTAATAGTCTGCT
TGCAGCACTTATAGCCCCATTGATGATCTTTCCACCATGAACCCCACACT
GTTGTGTGGTTATTAATTAGGACATCCTCTTCATATTTGCTCTTAGGAAG
AGCTACATCCTGTCCTTTGATTATGCGACCAGTCCGGTCATACTCAATCT
CTTTTTC
 
NBRP MacGene Copyright © 2012 NBRP-Wheat. All rights reserved.