Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs2o23
Contig Information
Length 757 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs2o23   
Homology (BLAST) Top Hit Os08g0127700 [Oryza sativa (japonica cultivar-group)] >gi|75136283|sp|Q6ZK48|SLU7_ORYSJ RecName: Full=Pre-mRNA-splicing factor SLU7 >gi|150417959|sp|A2YQU8|SLU7_ORYSI RecName: Full=Pre-mRNA-splicing factor SLU7 >gi|42407714|dbj|BAD08862.1| putative step II splicing factor SLU7 [Oryza sativa Japonica Group] >gi|113622874|dbj|BAF22819.1| Os08g0127700 [Oryza sativa (japonica cultivar-group)] >gi|215708746|dbj|BAG94015.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765271|dbj|BAG86968.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215768211|dbj|BAH00440.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218200420|gb|EEC82847.1| hypothetical protein OsI_27673 [Oryza sativa Indica Group]
Score 640
Evalue 5.47935e-65
Total Hit Count 147
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs2o23
GTATGCCATGGGTTACCAGGGAAGGAGGTTACAAAGAACATATGAGAACAAACTTCGTTCTGCCTTTGGACATCAAGCGATCATATCTGTACTTCACAAC
ATCAGTAACTCACGAGCTGGCATGCCATCCCATCCCGTCTTCCTAGACACCCAGAGAATACAGACACAACAATCCGGCAAAGGATGGACAGGCAGCAGAA
GGAGTTCAGGCATAGGCCACGCAACCAGGGGACATGAAAGCCTAATTGAGAAAATCTTTCATAGGATCGTCGTGGCGGACTCTTGTCATACGGTAGGCCT
CCATGTCTTCCGCAGTGACCTCGTCATTCCACTTCACATTGTACTTTCTCTTTCTTTCGTCCATCTCTTCCTTCTTCCTCTTTGCCTCCTTCTTTAAGGA
TTCCTCAAGCAACTTCTGGTCGAGAACAAGATCCTGAGGAATATCTGTTCCCCAAGTGGCTAGTTTCTTTTCTTCTTGTCGTACAGGTTCCTCTTCGGCA
GCCTCCTTGCGGGCCATATTTTCCCTCATCAAATCAGCTGATGCTTCAGCAGCCTCGATTCCAGCAAGGCCTGTGCAATAACTATTTTTAATAGTCTGCT
TGCAGCACTTATAGCCCCATTGATGATCTTTCCACCATGAACCCCACACTGTTGTGTGGTTATTAATTAGGACATCCTCTTCATATTTGCTCTTAGGAAG
AGCTACATCCTGTCCTTTGATTATGCGACCAGTCCGGTCATACTCAATCTCTTTTTC
page-top