Top | About the KOMUGI | Related Sites | Update | SiteMap | Contact Us
Quick Search   for   
  Strains ( NBRP / Others ) Genes / Marker cDNA TAC Map Comparative Map BLAST
  DNA Seq. Organelles Chromosomes Microarray eWIS Tools Story of wheat (Japanese only) Textpresso(TEST)
 Japanese | English

  BLAST
  Tissue specific clones
  complex contig list
Query Form

  How to use Virtual Display(2012)

  Related Sites
  Download
  How to Order Resources

  MTA Sample


• > Contig Detail
/images/estsTitleEn2.gif
cDNA - Contig Detail
rwhcs3m08
Contig Information
Length 308 bp
Tissue Callus
Clones
rwhcs3m08   
Homology (BLAST) Top Hit homeodomain-leucine zipper I-class homeobox protein [Hordeum vulgare subsp. vulgare] >gi|168808785|gb|ACA29197.1| homeodomain-leucine zipper I-class homeobox protein [Hordeum vulgare subsp. vulgare] >gi|168808787|gb|ACA29198.1| homeodomain-leucine zipper I-class homeobox protein [Hordeum vulgare subsp. vulgare] >gi|168808861|gb|ACA29235.1| homeodomain-leucine zipper I-class homeobox protein [Hordeum vulgare subsp. vulgare]
Score 137
Evalue 3.86197e-07
Total Hit Count 18

Contig Sequence     [ Download ]
>rwhcs3m08
TCGATCTGCATGAAGTTGATAGTGATANCCNGCTCGTCTCANTATCNAAT
TATNCCATACAGGNTANANCACTCNACCACGCTGNTATCGGCGTANCCAC
CATACTCGGGGACGCACATCNTCAGGTCATCGNCCGGCCCCANNACGTCT
GCGCCGCTGAAACCCGGATGCTGCTGGCAGGTTCCCGTCGAGAAGGACGA
GCTCGGGCTCCCGACACACGCGCCAACGGCGCCAGCGGAGTCTCCACCGT
CGCCGGATGCTCCGTGGCTCCNAGCTGCCGACCTGAGGCGTCNCACCTNC
TCCTCGGT
 
NBRP MacGene Copyright © 2012 NBRP-Wheat. All rights reserved.