Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

whcs13i06
Contig Information
Length 677 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs13i06   
Homology (BLAST) Top Hit hypothetical protein OsI_23688 [Oryza sativa Indica Group]
Score 488
Evalue 1.84821e-47
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whcs13i06
GACTTTGAGGTATTCTGGGATCTGCAGGACTTCTTGAACGTCTGCAAGCTTACATCTAACGACATACATGCTATGTTGAGGACATACGGGGTGGAGGCTG
CGAGGGCCACCATCATTAACGAGGTGAAGGCCGTATTTGAGCCCTTTGGCATCAAGGTAGACCCGAGGCACCTGAGCCTAGCGGCTGATTACATGACCTC
GGGAGGCTCCTACCGACCGATGAACAGCCTCGGGATGGCCCGGTTCTGCACGTCGCCGTTTGGCAAGATGAGCTTTGAGCAGGCCACGAGGTTCATCACG
GAGGCGGCCTACCATGGGGAGGTGGACAACCTCACGGGCCCTTCGGCGACCGTGTCCCTGGGGAAACCGGCCAAGACCGGGACCGGTGCCTTCGGGCTGA
TGCAGAATATCACCCTGGAGGAGCGGGCGGTGATGTAAGAGTGCCCTACTCGGACCTTGCTTTGGCATAGATCACAAGAATCTGTTGCTGCGTGTCCAGC
CATCACTCGTGTGTTTTGAGGGAATTAGTCATGTGAATAACTTTTTTGTGCTTGCTAANAGCAAAGCGATGTGATTCTCACCTGTTTGTATCTACTATAC
TACTCATGTANCTTAAGTTTCTGTCTATTTGGTACNATANATGCATCCGTTGCATTGCANTTANCTTAAAAAAAAAA
page-top