Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs3n10
Contig Information
Length 869 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs3n10   
Homology (BLAST) Top Hit Os12g0236400 [Oryza sativa (japonica cultivar-group)] >gi|585337|sp|Q08479|KAD1_ORYSJ RecName: Full=Adenylate kinase A; Short=AK A; AltName: Full=ATP-AMP transphosphorylase A >gi|391877|dbj|BAA01180.1| adenylate kinase-a [Oryza sativa] >gi|77554109|gb|ABA96905.1| Adenylate kinase A, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113648969|dbj|BAF29481.1| Os12g0236400 [Oryza sativa (japonica cultivar-group)] >gi|125536202|gb|EAY82690.1| hypothetical protein OsI_37905 [Oryza sativa Indica Group] >gi|125578925|gb|EAZ20071.1| hypothetical protein OsJ_034280 [Oryza sativa (japonica cultivar-group)] >gi|215697656|dbj|BAG91650.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765406|dbj|BAG87103.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1151
Evalue 3.90779e-124
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs3n10
GCTGTAATGAAATTGTGCAATAGTGCACATGCAGACAGAAAATGAGAAACATAGGATGCCGGTATGAGTTTAAAACTTGTAAGAAACCCAGCCGGGGTTT
TGTTACATGTCACTTTCAAGGTGAAACAGGCCCTTCACGAAAGAGCTTTCTGCAGCTCGGCGGTCACTTCCTTTGGTGGTTTCTCCGCATGAAGATTTGC
CACTAAGCCATTCTTGGAGTAGTAGTCAATCACAGGTTCAGTTTGTATGTGGAAAGCTTCAAGCCTTGACTTCAAGACCTCAGCTGTGTCATCTTTTCTT
TGAATTAAGGGTTCTCCCGAAACATCATCAACTCCCGGAGTCTTGGGAGGAGCAAATTTTGTATGGTAAGATCTACCACTCGATGGGTGTATCCAACGGC
CAGTAATTCGTTCTTCCAATATTGCATCATCAATTGCAAAATTTAGAACCTTGTCAACCTTAGCACCTTGCTTTGCGAGCATTTCATCGAGCTTTTGTGC
TTGAACAACAGTTCTAGGGAAGCCATCAAGGATAAAACCTTTTTGACATGAAGGTTTTTTCATGGCTTCATCAATAATCCCAACAACCAAGTCATCTGAA
ACAAGCTCTCCCTTGTCCATAGCTTCTTTAGCCTTGATACCCAGAGGAGTCTTAGCGGCGACAGCAGCCCTCAGCATATCGCCAGTGGCTAAATGGCACA
AACAATATTCATCCTTAATAAGGGGAGACTGTGTTCCCTTTCCAGAGCCAGGTGGACCGACGAGGATGATGCGCTTGTCGGGCTTGGAGCTGCACTTGGC
GCGACGGAGCAGCTCGGTCATGAGCTCCACCGAAGGCACGTCCTCNATGNTCGTCGCCATCTCTTCCTC
page-top