Top | About the KOMUGI | Related Sites | Update | SiteMap | Contact Us
Quick Search   for   
  Strains ( NBRP / Others ) Genes / Marker cDNA TAC Map Comparative Map BLAST
  DNA Seq. Organelles Chromosomes Microarray eWIS Tools Story of wheat (Japanese only) Textpresso(TEST)
 Japanese | English

  BLAST
  Tissue specific clones
  complex contig list
Query Form

  How to use Virtual Display(2012)

  Related Sites
  Download
  How to Order Resources

  MTA Sample


• > Contig Detail
/images/estsTitleEn2.gif
cDNA - Contig Detail
rwhcs3n10
Contig Information
Length 869 bp
Tissue Callus
Clones
rwhcs3n10   
Homology (BLAST) Top Hit Os12g0236400 [Oryza sativa (japonica cultivar-group)] >gi|585337|sp|Q08479|KAD1_ORYSJ RecName: Full=Adenylate kinase A; Short=AK A; AltName: Full=ATP-AMP transphosphorylase A >gi|391877|dbj|BAA01180.1| adenylate kinase-a [Oryza sativa] >gi|77554109|gb|ABA96905.1| Adenylate kinase A, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113648969|dbj|BAF29481.1| Os12g0236400 [Oryza sativa (japonica cultivar-group)] >gi|125536202|gb|EAY82690.1| hypothetical protein OsI_37905 [Oryza sativa Indica Group] >gi|125578925|gb|EAZ20071.1| hypothetical protein OsJ_034280 [Oryza sativa (japonica cultivar-group)] >gi|215697656|dbj|BAG91650.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765406|dbj|BAG87103.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1151
Evalue 3.90779e-124
Total Hit Count 500

Contig Sequence     [ Download ]
>rwhcs3n10
GCTGTAATGAAATTGTGCAATAGTGCACATGCAGACAGAAAATGAGAAAC
ATAGGATGCCGGTATGAGTTTAAAACTTGTAAGAAACCCAGCCGGGGTTT
TGTTACATGTCACTTTCAAGGTGAAACAGGCCCTTCACGAAAGAGCTTTC
TGCAGCTCGGCGGTCACTTCCTTTGGTGGTTTCTCCGCATGAAGATTTGC
CACTAAGCCATTCTTGGAGTAGTAGTCAATCACAGGTTCAGTTTGTATGT
GGAAAGCTTCAAGCCTTGACTTCAAGACCTCAGCTGTGTCATCTTTTCTT
TGAATTAAGGGTTCTCCCGAAACATCATCAACTCCCGGAGTCTTGGGAGG
AGCAAATTTTGTATGGTAAGATCTACCACTCGATGGGTGTATCCAACGGC
CAGTAATTCGTTCTTCCAATATTGCATCATCAATTGCAAAATTTAGAACC
TTGTCAACCTTAGCACCTTGCTTTGCGAGCATTTCATCGAGCTTTTGTGC
TTGAACAACAGTTCTAGGGAAGCCATCAAGGATAAAACCTTTTTGACATG
AAGGTTTTTTCATGGCTTCATCAATAATCCCAACAACCAAGTCATCTGAA
ACAAGCTCTCCCTTGTCCATAGCTTCTTTAGCCTTGATACCCAGAGGAGT
CTTAGCGGCGACAGCAGCCCTCAGCATATCGCCAGTGGCTAAATGGCACA
AACAATATTCATCCTTAATAAGGGGAGACTGTGTTCCCTTTCCAGAGCCA
GGTGGACCGACGAGGATGATGCGCTTGTCGGGCTTGGAGCTGCACTTGGC
GCGACGGAGCAGCTCGGTCATGAGCTCCACCGAAGGCACGTCCTCNATGN
TCGTCGCCATCTCTTCCTC
 
NBRP MacGene Copyright © 2012 NBRP-Wheat. All rights reserved.