Top | About the KOMUGI | Related Sites | Update | SiteMap | Contact Us
Quick Search   for   
  Strains ( NBRP / Others ) Genes / Marker cDNA TAC Map Comparative Map BLAST
  DNA Seq. Organelles Chromosomes Microarray eWIS Tools Story of wheat (Japanese only) Textpresso(TEST)
 Japanese | English

  BLAST
  Tissue specific clones
  complex contig list
Query Form

  How to use Virtual Display(2012)

  Related Sites
  Download
  How to Order Resources

  MTA Sample


• > Contig Detail
/images/estsTitleEn2.gif
cDNA - Contig Detail
rwhcs2p16
Contig Information
Length 669 bp
Tissue Callus
Clones
rwhcs2p16   
Homology (BLAST) Top Hit Os05g0347000 [Oryza sativa (japonica cultivar-group)] >gi|55167947|gb|AAV43816.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113578816|dbj|BAF17179.1| Os05g0347000 [Oryza sativa (japonica cultivar-group)] >gi|215766445|dbj|BAG98753.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218196597|gb|EEC79024.1| hypothetical protein OsI_19562 [Oryza sativa Indica Group]
Score 436
Evalue 1.91673e-41
Total Hit Count 163

Contig Sequence     [ Download ]
>rwhcs2p16
AGCAGTTTACGATCACCCTTATGACCTCTTCCACCATGGTGCAAAGTCGC
ACACATCCTAATATTATTCAGATGATAACCAATAGGTCCTAAAAAGACAA
CAAGCGCCCTTGCTTGGTAAAAATACACTTTCTCTGATCTGAATCGCTTA
ATTCACCAGACTGCGCGGCCAACGGCAGCTGCAGTATCTATTCTGGTCCA
CTTCAGTTCTCCGAATCGTCAGAGTCACTCCTCTCAGGCTCAGCTTCTTC
GCCATTTGCAGCAGGCTCTTGAGCGTCTGGCTTGGGTGCAGGAGCTGGTG
CAGCTTTCTTGCGGTCACCACCTTCACCACCCCCACCTTCACCACCTTTG
ACAGACACTCCATGCATAATACTTATAAGATCCTTCTCAACTCGGTGAAC
AAGCTCTGCATTCAAGCCAGGCTCTCTGCGATAACGTCGCCTACGTGCAT
CCCTCATTGGAGGAGTAAGTCCATGCTTGTATTCAACTTCTTCTGGAGCA
GGATCAACATCTTCTCTTACCATTACCATCTGACCAATATCAGCAGCTTT
AACTAAGAATGAATCATCATATGTCTTATACGACTCCACAACAGTTGGGA
GATCCAAGAGAGATGCAGGAAAGCTCTGGTTACCAATCATAAATGTGCCA
CTTCTTCCATCATCTGAAA
 
NBRP MacGene Copyright © 2012 NBRP-Wheat. All rights reserved.