Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs2p16
Contig Information
Length 669 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs2p16   
Homology (BLAST) Top Hit Os05g0347000 [Oryza sativa (japonica cultivar-group)] >gi|55167947|gb|AAV43816.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113578816|dbj|BAF17179.1| Os05g0347000 [Oryza sativa (japonica cultivar-group)] >gi|215766445|dbj|BAG98753.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218196597|gb|EEC79024.1| hypothetical protein OsI_19562 [Oryza sativa Indica Group]
Score 436
Evalue 1.91673e-41
Total Hit Count 163
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs2p16
AGCAGTTTACGATCACCCTTATGACCTCTTCCACCATGGTGCAAAGTCGCACACATCCTAATATTATTCAGATGATAACCAATAGGTCCTAAAAAGACAA
CAAGCGCCCTTGCTTGGTAAAAATACACTTTCTCTGATCTGAATCGCTTAATTCACCAGACTGCGCGGCCAACGGCAGCTGCAGTATCTATTCTGGTCCA
CTTCAGTTCTCCGAATCGTCAGAGTCACTCCTCTCAGGCTCAGCTTCTTCGCCATTTGCAGCAGGCTCTTGAGCGTCTGGCTTGGGTGCAGGAGCTGGTG
CAGCTTTCTTGCGGTCACCACCTTCACCACCCCCACCTTCACCACCTTTGACAGACACTCCATGCATAATACTTATAAGATCCTTCTCAACTCGGTGAAC
AAGCTCTGCATTCAAGCCAGGCTCTCTGCGATAACGTCGCCTACGTGCATCCCTCATTGGAGGAGTAAGTCCATGCTTGTATTCAACTTCTTCTGGAGCA
GGATCAACATCTTCTCTTACCATTACCATCTGACCAATATCAGCAGCTTTAACTAAGAATGAATCATCATATGTCTTATACGACTCCACAACAGTTGGGA
GATCCAAGAGAGATGCAGGAAAGCTCTGGTTACCAATCATAAATGTGCCACTTCTTCCATCATCTGAAA
page-top