Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

rwhcs2p23
Contig Information
Length 703 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs2p23   
Homology (BLAST) Top Hit protein kinase [Triticum aestivum]
Score 688
Evalue 1.28383e-70
Total Hit Count 181
Registered year 2003
Contig Sequence     [ Download ]
>rwhcs2p23
TAGCAAGTATACACNTTATGCTGTAGCCAGTAATAGCCGAGGACCCATCGCCGAGACTGTCAACCCAACATACGGCGAACCAAACAGGCATCACTGCTAA
CATCAAACACCATACTATTTTGGAGACAGGGGATGGATGTTGTTTTAACAAATTCACTAAAAAGAAAGCATCGGTTAGGATTTACAAAAGCTGGACGGGG
TAACACCAAGACCAAAAGGCAACAGTTTTTTTTCCTCTCTTTTACTTTTCTGTGGTTTACTTTTCAAAACCTCCATATCCTATTTACGTCGAGGTTGGTA
TTGTTCTGGTGGGGCGCTTGAGTGAGAAGAAGGTTGTCCCTCCTTATGGGGCAACATATTTAAGAAACCGCCGTGCACAGGTTCATCTTCATCCATGCTC
TCAAACAATGTCTTGATGGTTGGCCGTTTTGATTTGGAACTCTTTTTCTTCAGCTCGGCAATCCCGGCAACTTCATCGTCATTCACAATTTCAAAGTTCT
TGTACGTGTATCCAACAAAATTTGCATCCTTGGATGGAAGCATCTTTCTCCATGGACCCGCCTTAGATGAACTCTGAACTTGTGCTCCAGTCTCCTCAAA
TTTCTCAAAGTTCTGAGTATCCAACTCGCCATTAACTTCTGGTATGAAAGCAGCTTTCATCTGATACAACTTTTCCCCATTGGACACCTCTAAACCATGT
ATG
page-top