Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_V4816_all.Contig98
Contig Information
Length 1192 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n1o17    rwhv16n1o17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit vesicle-associated membrane protein-associated protein [Triticum aestivum]
Score 794
Evalue 1.61008e-82
Total Hit Count 390
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig98
AAACCATTTCCGTGCAACCTTTTTATGCCCGAGACAGTAGGAGGACAAGAGCGAGGGCGACCAATAAATTCCTAATTTTTCCCACTTTTCCACCCCGGGA
TTCCCCCGCCTCTTGTTCCAATCGATTGGTGGGCGTCCTCGTTCTTGGCTTCCCGATTGAATCCGTGGAAGCCAAAGATAATTCTATCTCCGCTGCGATT
TTTTTGGGTGGTTTGAGTTCTTGATTTGTTTGCGAGGAAGCCACCATGAGCGCCGGAAGCGCGAGTTTCCTCGAGATCCAGCCCTCGGAGCTGGCATTTC
CCTTTGAATTGATGAAGCAGAGCTCGTGCTCCATGCAACTCGCAAATAAGACCGACCATTATGTAGCATTCCAAGGTCAAAACTACCAACCCAAAGCAGT
ACTGTGTGCGCCCTAATATTGGCGTTGTACTTCCTGGGTCGACTTGTGATGTTACAGTTACAATGCAAGCGCAGAGGGAAGCACCTCCTGATCTGCAGTG
TAAGGACAAGTTCCTAGTTCAAAGTGTTGCAGCTGAGAATGGTGCAGCAACTCAAGATATTAGTGCAGCAATGTTCAACAAGGAGCCAGGGAAGGTTGTT
GATGAATGCAAGCTGCGTGTAATTTATGTGCCAACATCTTCACCTAGCCTGTTCTCTGAAGATTCAGAACAAGGGAGTTCTGCTCGTTCATTGGAAAACG
GGACTCCTAATTCTACATTGCCACAATCTGTATTTAGATCATCTGGTGAAGCATCAAAGGAGAAGTCCTCGGAGGCAACATCCATGATTTCCAAGCTAAC
TGAGGAGAAAATGTCTGCTGTTCAGCAAAACCAGAAGTTGAGACAAGAGCTGGATGTCCTACGCAAAGAGAGCAGCAAAAGCAACGGCGGTTTCTCAATC
ACCTTCTTGATTGTGGTGGGTATTCTGGGCATCATCGCTGGTTTCATCCTCAAGAAGACATAGGAGAAGAGTAGTCCCCAACAAAGTTACATTCCCAGGA
AAGGATGGATACCAACAACATCCCTTGTGTTTTTACTCCTAAAAGGAGCGCCTGTTCTATTCTAACTTGTAACGGCTTAGAAGCTTTGGTTTGTGTACAT
TACATGGTGGTTTTCGTGATTTTAATCACATCGAGTAGACTTGTTTTAATTATAATTCTTAACCAGCTGCAAGTTATGTCCACGTCCACCAT
page-top