Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_V4816_all.Contig97
Contig Information
Length 1166 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n2f18    rwhv16n2f18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative 2-C-methyl-D-erythritol 4-phosphate cytidyltransferase [Oryza sativa Japonica Group] >gi|56785242|dbj|BAD82130.1| putative 2-C-methyl-D-erythritol 4-phosphate cytidyltransferase [Oryza sativa Japonica Group] >gi|125572904|gb|EAZ14419.1| hypothetical protein OsJ_004244 [Oryza sativa (japonica cultivar-group)] >gi|218189493|gb|EEC71920.1| hypothetical protein OsI_04715 [Oryza sativa Indica Group]
Score 1178
Evalue 4.61533e-127
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig97
CAGCGCCTCCGGCATGGAGCTCCGCCTCTGCCTCCACCTCCACCTCCACCTCCACCTCCACTCCCACGCGCGGCCCCCTTCCGCCCCGACGCCGCCTCCA
TGCCCCGCGGCCGTACTGCTTCCCGTCCGCCGCCTGCGGATTGGTGGGAGCTGCGGGGTTGCTCCGCGGCGGAGCACGAGGCGTTCGCATTCAGCCATCT
GCGCTGCCGAACCAGACGGCGCGCAGGGCGGGGAGGCTGTCAAGGAGAGGAGCGTCTCGGTGGTCCTCTTGTCCGGAGGGCAAGGAAAGAGAATGGGGGC
CAATATGCCCAAGCAGTATCTACCATTACTGGGAGTACCAATTGCACTGCACAGTTTAAGGACATTCTGTGGAATGAAGGAAGTGAAAGAAGTCGTAGTG
GTGTGCGATCCGTCCTACAAAAATGTATTTGAAGGTTTTGTTGAAAACCTGCAAATACCTATGAAATTTACAACCCCGGGAAAAGAGAGACAAGACTCTG
TTTTTAATGGACTTCAGGAAATTGATGGAGATTCAGAACTTGTTTGTGTCCATGATTCTGCAAGACCCTTGGTATCCTCTGAAGATGTAAAAAAGGTCTT
GGAAGATGCTGCCGTGCATGGAGCAGCTGTTCTTGGTGTGCCTGTCAAAGCTACTATAAAGGAGGCCAACAGCGATTCTTTCGTCGTAAAAACCCTCGAT
AGGAAAACCCTCTGGGAGATGCAAACTCCACAGGTGATGAAACCTAATTTGCTCAAAGATGGTTTCGAGCTAGTTAAGAGGGATGGCCTTGAGGTCACTG
ATGATGTTTCCATCGTAGAATACTTGAAACATCCTGTTTATATCACTGAGGGCTCTTATACAAACATCAAGGTGACTACTCCTGATGACATGCTCTTAGC
TGAGCGTTTGATGAACGATAAATAGGGCCAATATTAACAATGTTTACTTCATTTGAGAGGCACCTGTATGAATTTGTCAGTACGACATTCCATTGCCTTT
CCACAGTTTTGGCCTCTTGGGAACTAGAAAAATAAACATGTACTCCCTCCGTCCCAAAATATAATAATGTTTTTAACACTAGCATCATGTCAAAAACGTT
CTTATATTCTGGGACAGAGGGAGTAGCTCATACACGAGATAGATAACCTGTACGTAACATTCTTTC
page-top