Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_V4816_all.Contig93
Contig Information
Length 1210 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n2g21    rwhv16n2g21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit iron/ascorbate-dependent oxidoreductase [Hordeum vulgare]
Score 1375
Evalue 7.01383e-150
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig93
CGCAGAAGCAGAGCTCCCTCGGCCACCGTCGATGGTGCGGACGACGGTGCAAGAGCTGGCGGCGGCCGTCGAGGAGCCGCCGCGACAGTACGTGGTGGCG
CACGAGCAAGACCAGGACCTGCTGGCCGCTGATGAGATGCCGGAGCCCATCCTTCTCATCGATCTTAGCCGGCTGACTACGGCCGACGCCGCCGACGAGG
CCGACAAGCTCCGGGCGGCTCTCCAGACCTGGGGCCTCTTCCTGGTGACCAACCATGGAATCGAGGAGTCTCTCATGGATGCCATGATGAGTGCGTCGAG
GGAATTCTTCCGGCAACCGTCCGGAGAGAAGCAGAAATGCAGCAACCTGATAGACGACGGCGGCAAGCACTCTGAGGTGGAAGGGTATGGAAATGACAAG
GTGGTAAACCAGGATGAGAGCCTCAGCTGGAACGACCGGCTGCATTTGAGAGTGGAGCCAGAAGATGAGAGGAATTTCACCAAGTGGCCCACTCACCCGG
AATCTTTCAGGGATGTGCTACTTGAGTACGCATCAAGAACCAAGAGGATAAGAGACGTGGTCTTTCGAACAATAGCCAAGCTCCTGGACCTTGATGAGGA
TTACTTCCTCAACCAAATGTCAAACAAGGATCCCGGGTTTGCTAGGTTCAACTACTACCCTCCGTGTCCGCGACCTGACCTGGTATTAGGCATGAGGCCT
CACTCTGATGCTGGTCTCCTTACCATCCTTTTTGTCGACCGCGACGTCGGTGGCTTGCAAGTTGAGAGAGATGGGAAATGGTACAATGTTCCGGCCAAGC
CTTATTCGTTGGTGATCAACTTGGCTGACTGCATGGAGATAATGTGCAACGGAATCTTTAGGAGCCCGGTTCACAGGGTGGTGACGAATGCCGAGAAAGA
GAGGCTTTCACTGGCCGTGTTTTATGCTGTGGATGGAGAAACGGTGCTGGAGCCAGCGCCTGGTTTGCTGGATGACGAGCGACCGCCAAGATATGGGAAA
TTCAAGGCCAAGGATTTCGGTCTTTCTTTCGACTGAACATAACATTTCAGCCAAGGGAAGAGATTCATCGAGACCCTGAAAATACAAGCTCGGCGGTCTT
AATTAGTTTATTTACGGATTTGTAGCGGTGATTTAATACCTATGGAGTATAAATAAAGAGATGGTCTCTCTTCTGTGAGTGGGGATTTTATGTACGTATA
ATATAATCGC
page-top