Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_V4816_all.Contig79
Contig Information
Length 1026 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12m12    rwhv16n12m12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_29365 [Oryza sativa Indica Group]
Score 1293
Evalue 1.7683e-140
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig79
AAGAATTGATATGCTTTTTGTACTTGGTGGAAATGGTACCCATGCAGGAGCAAATGCTATCCATGATGAGTGCCGTAAAAGAAAGCTCAAGGTTTCTGTT
GTAGCAGTTCCAAAGACCATTGACAATGATATACCTTTAATGGACAAAACATTTGGTTTTGATACCGCTGTGGAAGAAGCTCAACGGGCCATTAATTCTG
CCTATATAGAGGCACGTAGTGCGTATCATGGTATCGGCTTGGTGAAATTAATGGGAAGAAGCAGTGGTTTCATTGCAATGCATGCTTCTCTTTCAAGTGG
GCAGGTTGATGTCTGCTTAATACCAGAGGTCTCATTCGCGCTCGATGGAGAATATGGTGTTTTACAGCACCTCGAGCAGTTAATAAAGAACAAGGGATTC
TGTGTGGTTTGCGTTGCTGAAGCTGCAGGACAAGAGTTACTGCAAAACTCAGGCGCAACTGATGCATCAGGAAATACAATACTTAGCGACATTGGTGTTC
ACATGCAACAAAAGATCAAGACGCATTTCAAGGGCATCGGTGTCCATGCTGATATAAAATACATCGACCCGACGTACATGGTCCGGGCTTGTCGTGCCAA
TGCGTCCGATGCGATTCTGTGCACCGTGCTTGGGCAAAATGCCGTCCATGGAGCGTTTGCCGGGTTCAGTGGCATCACTTCCTGCATCTGCAACACTCAC
TATGTGTACCTTCCGGTCACGCAAGTCATCACGGCACCGAAGCGTGTAAACCATAAGGGCAGGATGTGGCACCGTTGCCTCACGTCCACAGGCCAGCCGG
ACTTCCGCTGACCACCTGTTGCTACAGAACTTGAATGATAAGTGCTATGGAATTTCGGTGTTAAGTTTTTGCCCTGTGCAATCAGTTCGGTTTTTCTCTT
TGTGTAATCAGTGAAGTTTTTCAATGTTAAGTACTAGAGAATCTGAGTGCTGTGCTACATAATTAGTCCAGTTTTTGCTTGTGCAATCAGTTCAGCTCAA
CTTTTGCCTTGTGTAACCCTTCTTAT
page-top