Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_V4816_all.Contig74
Contig Information
Length 735 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n2k05    rwhv16n2k05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Thaumatin-like protein PWIR2; Flags: Precursor >gi|21879|emb|CAA41283.1| thaumatin-like protein [Triticum aestivum]
Score 860
Evalue 1.60033e-90
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig74
ACAGCACTAAAGCTAACTAGAGCTTCCAGCAATGGCGACCTCCCCGGTGCTCTTCCTCCTCCTCGCTGTTTTCGCCGCCGGTGCCAGCGCGGCCACCTTC
AACATCAAGAACAACTGTGGCTTCACAATTTGGCCGGCGGGCATCCCGGTGGGTGGGGGCTTCGCGCTGGGCTCAGGGCAGACGTCCAGCATCAACGTGC
CCGCGGGCACCCAAGCCGGGAGGATATGGGCCCGCACCGGGTGCTCCTTCAATGGCGGTAGCGGGAGCTGCCAGACCGGCGACTGCGGCGGCCAGCTATC
CTGCTCCCTCTCCGGGCGGCCACCAGCAACGCTGGCCGAGTACACCATCGGCGGCGGCAGCACCCAGGACTTCTACGACATCTCGGTGATCGACGGCTTC
AACCTTGCCATGGACTTCTCGTGCAGCACCGGCGACGCGCTCCAGTGCAGGGACCCCAGCTGCCCGCCGCCGCAAGCCTACCAACACCCCAACGACGTCG
CCACACACGCCTGCAGTGGCAATAATAACTACCAGATCACCTTCTGTCCATGAAGCCTCTATACGTCGCACCGCGAATCAATAAAAGGCGTACGTAGATA
TACGGCCATATAAATAAAAGGTGTACTGCTTAATACATCACATTGTCATATTACAGCCGCCGTACTACATGTTAGCCCACTACTATGAGCGTTTCATTGA
TATTTGTGTACACAGTACAGGGCAATAAAAAATAC
page-top