Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_V4816_all.Contig63
Contig Information
Length 634 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n2m12    rwhv16n2m12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit choline kinase [Oryza sativa (indica cultivar-group)]
Score 256
Evalue 1.2632e-20
Total Hit Count 286
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig63
GCACTTCTCGCGAGGAACCTGAAACGGAGGAGCTGGAGAATCTGCTCCAGAGCGTGGAGAAGTACACGCTCGCGAGTCATCTGGTTTGGGGCCTCTGGGG
AATAATATCAGATCGTGTCAGTGACATCGACTTCGATTACCAGGAGTATGCAAGGCAGAGATTCGAGCAGTACTGGCAGAAGAAGCCTGCCGTCCTAACC
TCATGAATAGCTGTACCTATTGCTTCAGGAACTCCCTGAGGGCCTGTGCTGCTGCACACAAACTGTGCAGTGTTACTAACACACATATCCCCTGGCTGGG
ATAATGACAGGAAGGATATGAAAGAAGCATACTATTACAAGGAAGCATAAGCCCGTTCCAGGGTCAGACGTTCCCATTTCGAACCTTGACAAGGTCCAGC
TTCAGAAAGGAAGCTGTCTATGGGGGCTTTGGTTGATTGTTTATAGGTATAGCCTCGACGGCTCGACGCAACGATGATAAAGCCTTGGAGTTGCATTTTG
TATGTTGTTTTCCTAAGCACCGCTGGTGGTGTTCGTGTGATTTTGTGCTAGTAATGTATGTATACTTGACGGACAAAGTATGTACTATAAGACATCTCGT
GAAAGAAGTAATTTCCTCACTTCCAAAAAAAAAA
page-top