Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_V4816_all.Contig61
Contig Information
Length 941 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n2m22    rwhv16n2m22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Picea sitchensis]
Score 159
Evalue 3.82832e-18
Total Hit Count 91
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig61
ATCTGATTAGTTATGTCGTTTGTGTACGCGCTACTGTGTTACTGTCAGATGATCCAGTTAAGTTTCTTTTTTTTTTGAACTGATCCAGTTCAATTTTATC
ATTTGCATTGCATGGTGATCAGTGCAACTGTTGGACCCAAGCTTTATTACACGTCGCAGTAACCTATTGTTTTTATTACCAAGACAACTGATGTAGAGAT
GAGTTGGTGAGCAGTGACTTGTTAGGACGGATCAAGGTCGACTTCAACTCTGTCTGGTACTCTAGAATTGCCAACTTCTTTCAGTTTTATCACACGAATC
GGGTGCGCTATGTGTGCTTCCTATACAGGACGAGGACATATGTTATAGGCTTCGTGAATCATTATGATTCTACCTCTGCAAACTGAAATCATGTTGATGT
TGCAATTGTATGGCTTCCTTTTCAGGGCTATGCTTTGTTATGTGTTGGTTACCCATCCTCTGATCTTGAAGTTGAAACGCAAGATGAAGATGAGGCAAGC
AATTCTCTTAAGACGCCTAATGAATTTCTAGTTCAAATATGCTATAGGAACTAGTATGAAATATTCTTCTGAATTCCGATGATTGCGCGTCTATCTCAAT
TTGTAGGTATATTGGCTCCAGTTTGGAAGATACTTTGCGCGGGGGCCTGTTGACAGAGATGATTACGCGCTAGAGCTTGCAATGGGAGACGAGTGAAACG
TGACTGACAGCGGTACGGTTTTTAAGCTGCGGTTTGTAGGTTATATAGAGTTGCAAAAAAGACTTGATTTGCAAGTGGAGAAAGAAGAGAAAACAAAAAG
ACCCCTCTGCTCAATGCTCTCTGTGTTTTTGCAAATTTGCTGTGCAAATATGCTTCTTGCAGAGATGCCATCCTTTTTGCTCCTCTGTATTCACAGTAGA
CGAAGAACGCTATGGACTGTATGTATGTAAAAAGCTGGAAC
page-top