Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_V4816_all.Contig59
Contig Information
Length 1158 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12k06    rwhv16n12k06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit csAtPR5 [Triticum aestivum]
Score 515
Evalue 3.45322e-50
Total Hit Count 175
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig59
GGATGAGGAGTTCTTTGATGAGTACCGTCGTGGCTGGGTATCGAATTGGTCCAGATTATATGGTACCTTCACAGAGACGACTTCATTGAGTCCTATGCAC
TTTACACACAGTACACCAGGAAACACCCCATCTGCGGCTTTTGTTGCTAGCACTCTGCAGATTTACTCCATCCAAGTTAAAGAAATAGAAGATGTTCCAG
GCTTGAAGTGGCCGATGGAAGTGTACGGCGTGATAGCTGCAAGAGACGATGTGGATCACAATCGCAACATACTCTTTTCCCGTCGAAGGAATAACTGCCA
AATACTCAATCAAGAGGATCCTTTTTTGCACTTGACTGGCCCGTCTCGTGCAATTGTATGTGAGGAACCTGTTCATGTGGAAATCAAGCTCAAAGTGAAG
GCTGGAACAGAGTCTGAAGATATTGCGTTGATGACTCGTGTCTGGTATTACAGCGGTAAAGTGTCATGTACTCTATATACCCCTGTTGTCGGAGGCTTAT
GCACAATGGTGTTAAGCTCAGAGGAACTTCATGAATCAGTCCAGGCTACTATCGTGGGTATCCGTCTCCGTGTTCCTGAAGAGACACCAAGTCTTTTCAA
AAACGGTGGCAGAGTTGTTTGCTTCTCTCTGCCTCGGAAAGGCAGGCCTCGGAAAGGCAGGTTGCCTAACAGTACTCACCCTTTATTTCGGCAAGTTGTG
CTTCAAGATGGAGCAATGACTAGTTGTTCAAAGGGTTACCTTAATCTGTCAAGGCATGTTGTCTCTGTAAAATTATGTGGAACGCTTGAAGTTGTCATAC
ATGCTAACTCGCAGTCTGGGGCTATCAAAGGTGAAGTATCCATCAAGGCCCAGAAATGCAATATAACTCAGGATGTGTGTCACCTTGGCGACTCTGAGCT
GGAAATCACAGTTGCTTGGTCCCGTCTAGTTCAAGACAAGCTGTGGATCTCAATGGAGGGAAGTGAGGAAGTTTGATTGTGCTCAGGCGTTATGAAAGCT
GTCAGACTTAGTATTTCCAGTGTTCTGTATTGTAGAAGTGTATTTTGTATTTCCAGTGTTGTGTATTGTATTAGTGTATCCTATTATGTAATGTGGTACT
GACCAGTATGTCACAAAATATCTGACTGTTTGTGTATAGGTCTTGTCTCGTCAGCTTT
page-top