Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_V4816_all.Contig50
Contig Information
Length 589 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12j07    rwhv16n12j07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_003319 [Oryza sativa (japonica cultivar-group)]
Score 280
Evalue 1.75611e-23
Total Hit Count 113
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig50
GCCGCCGGCATATACGGCATCCTGAAGAAGCTGGGCAGGGACAGAGCGCCGAGTGACGGCAGTCCGAAGCAAAGGACCGTCGTCGCCATAGATGGCGGCC
TCTACGAGCACTACAAGAAGTTCAGCTCCCGCGTCGAGGCGACGCTCGCGGAGCTGCTCGGGGAGGCGGCCGCCTCGTCGGTCGTCGTCAAGATGGCCAA
CGACGGCTCCGGCATCGGCGCCGCGCTTCTTGCGGCCTCACACTCCCAGTACAATGTCGTCGAGTAGTCCCAAGGAGAGGGAGTGAGCTCCTGGCGCGGC
TTCTTGCTTTCGCCTCGATCACTTATTTTGCCATTTCTCTCCACTGATAGCTAGTCTTGTGCCAATGAGTTCCGTTTGCAACCGCGGGAAGGCGGAAACG
GAGACGGAGGTTAGAATGACGCCGCTCCTTTCCTGCCAATTCTTTTTCCCTAAACCTGCAAGTTTCTGTTGCGATGCCATGTCGCGAACCAAACAGAGGA
GACCTGCCTGCATCTGATCTTCTATAATTCAGAATAAGGAGGGTGGTATATATATGATCGCATAATTGAAACATTTATGAAAAAAAAAA
page-top