Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_V4816_all.Contig48
Contig Information
Length 1122 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n2p15    rwhv16n2p15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Oryza sativa Japonica Group]
Score 386
Evalue 6.86235e-39
Total Hit Count 256
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig48
ATTCATGGAGGAAACATGTTTAGGCAAGAGCGCAGCACATTGGTCAACAGAACTGATGATTTTTACAACACAAATCTCTCGTTAGGAAGGCCAAGCAGTT
TCCGTGGAAAAGAAAATGTACCACCAAAGAGGATTGTCCAACCAAGCAGGTACCGTAGCTCACTATACGGCTGCAGTGAGAGGGGCCAAATAATGCCACA
TGAGAGAAAGATGTATGAGAACATAACATCCTTGGCCAATGTTGAAGGATCCAAACCTGCAGTTTTGATTGACAAAACCATCGCCACATTTGGACAGTTG
GGTAACTCGAAGAAAATAGGTGGCCGGGTCCAGGCCTATGTCATAAATGTGTACTGCAGGCACCTATTTAATGAAAATCATCCTAGGAACTCACTCAAGC
ACTATTTCTTCCATACTGCATCTGAATATTTCCTGGGCAAATGGAAAAATGATGAGGCAAGAATTTGGTGGAGGAAGAAACTGATTAGAAGTTTCATTGG
AGCTGGAAAAGCACATAATCTTTTGATGTCAGACAAGTTGTACTTTCCAACACTACACGAGGAATATTACTTTCTGTTCGTCGTCGACATCAAGGGTCGC
ACATTTTATTTTTTGGATTCTTTCTATGATGAGAATAGCTCATATCATATGAACATAAAAAAGAAGATTATCTCAAGCTTTATATGCACTTGGTACGAAG
CTCGGCTCCAGCCAATGGATTTCAGTGCATTCCCTACTGTTTACCCTAAAGTCCCTCAACAAGATAACGATATTGATTGTGGCATTTTCACTATGAAACT
AATGGGGATGGTGCCCAAGGAATCCAACCCCTATAGTTTTTTCACCAAAAAATGTCCCAGATGCAAGGATCCGATATGCTGTTGATCTCATGTTCAGCCA
CTACAACACTTTGGATGACGAGAAGAAGCGTGTCAAGGAGTTCCGCCTATAGACATGAAAAAGTGCTGACAGCTCCTAAAAGACACCACTCACAATGACA
AGAGGAGCTATATCAAGAGTCATATTAGCAAAATCAAAGGAAAGATGAGATGTATCAAACACATAGTTAGCAATTGTTAAACATTTTCGAGATGTTTTTC
TATTTTTTGTATGAACAGAGAA
page-top