Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_V4816_all.Contig47
Contig Information
Length 862 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12j01    rwhv16n12j01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit transposon protein, putative, unclassified, expressed [Oryza sativa (japonica cultivar-group)]
Score 979
Evalue 1.34384e-105
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig47
CTGCTGCAGAGGAACAGCAGCCACCGGGGCTACACCCCCGCCCTACGCCGAGAAGCTGGACGAGTCGTCCGAATTCCAGGGAGACCTCAAGGAGAGTTTC
TACATTGGGGCGGTCAGGGATGTAGATATGCCGAATGATCCTAACCAATGGCCTCCTAAAGAGCGCTTTCCATCTTGGAAGGATACAATGAAGCTGTACC
ATGAAGCTGCACTGGCTGCTGGCAAAAGGATACTCTCTCTAATTGCTCTGAGTCTGGACCTAGAAGCTGAATTCTTTCAGAAGATTGGTGCAGTCAACTG
CTCTTCAGAAGTTATTCGGCTATTGCACTACCCAGGTGAAGTAAACGAGTCTGATCATGGAAATTATGGTGCATCAGCTCATTCAGATTATGGAATGATA
ACTCTTCTAGCAACAGATGGCACTCCTGGCTTGCAGATATGCAGGGAGAAGGATAGGCATCCCCAGCTCTGGGAAGATGTTCGTCATGTTGATGGGACCC
TTATTGTTAACATTGGCGATTTGCTAGAAAGGTGGACAAATTGTGTTTTCAGATCTACACTTCATCGGGTTGTTGCAGTTGGCAGAGAGCGATATTCTGC
GGCTTACTTTCTGGACCCAAGACCCGATCTAGTGGTGCAGTGCTTGGAAAGCTGTTGCTGCGACGCATATCCTCCAAGGTTTCCACCTATCACGGCGGGT
GACTATTTGAAAGAACGATTAAGTGCCACATACAAATAACTGAAGACAGAGTTGTATTTCCTGTAAAATAGCAATGTGTACTATGACTGTAAAGGTAGTT
GTATTTCAGTACAGTTGTAACGGTTCTAGTGCATGTCTGACTAAATCTGTATCGTCATAATA
page-top