Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_V4816_all.Contig46
Contig Information
Length 792 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n2p23    rwhv16n2p23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Cu/Zn superoxide dismutase [Triticum aestivum]
Score 796
Evalue 4.90781e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig46
CTTCCGCTCCCGACGACCGCCATGGCCGCTCAGAGCCTCCTCTTTGCCGCCGCCGCGCCTCTCTTCCAGGCTCCTGCCTCTGCCCGCCCTTTCCAGTCGC
TCCGAATTGTCTGCACCCCAGAAGGCGCCACCGCCGCCGCCAGGGCGCTCGTCGTCGCCGACGCCACCAAGAAGGCAGTCGCGGTGCTCAAGGGCACCTC
GCAGGTCGAGGGCGTCGTCACGCTCACCCAGGAAGACGACGGTCCTACGACGGTGAACGTTCGTATCACTGGACTTGCTCCTGGACTTCATGGCTTCCAC
CTCCATGAGTTTGGTGACACGACTAATGGATGCATATCAACAGGTCCACATTTTAACCCAAACGGCCTGACACATGGTGCACCAGAAGATGAAGTCCGTC
ATGCGGGTGACCTGGGAAACATTGTTGCCAATGCTGAAGGTGTGGCGGAGACAACCATTGTCGATAGCCAGATTCCTTTGACTGGCCCTAATGCAGTTGT
TGGGAGAGCGTTTGTTGTTCATGAGCTTGAAGATGACTTGGGAAAAGGTGGGCATGAGCTCAGCCTCAGTACTGGAAATGCTGGTGGAAGACTTGCATGT
GGTGTTGTTGGCCTGACCCCGTTGTAGGTCGCTGGTTTCCATCTCTGGTTTTGCATCTCCAGTCATACTGGTTTCCATCTCTGGTTTTGCATCTCCAGTC
ATACTTGTAACGACGCCATTCTCGTTTTACCTGGATTTCAAATATCGGATGCTTAATAGTTTCTGTTGATCGTTTGTATCAGTGAAAGTGGT
page-top