Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Contig Detail

Wh_V4816_all.Contig42
Contig Information
Length 1152 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12i06    rwhv16n12i06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit apoplastic invertase 1 [Hordeum vulgare subsp. vulgare]
Score 1547
Evalue 7.37003e-170
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig42
ACAGCCTCGACCTGCGCCGCTACGACTACTACACCGTCGGCACCTACAACCGGAAGACCGAGCGGTACGTGCCGGACAACCCCGCCGGCGACGAGCACCA
CCTGCGGTACGATTACGGCAACTTCTACGCCTCCAAGACGTTCTACGACCCGATCAAGCGCCGCCGTATCCTGTGGGGCTGGGCCAACGAGTCGGACACC
GCCGTCGACGACGTCGCCAAGGGATGGGCCGGAATCCAGGCGATTCCGAGGAAGGTTTGGCTGGACCCGAGTGGGAGGCAGCTGATGCAGTGGCCTGTGG
AGGAGCTTGAGGCGCTGAGGGCGAAAAAGCCGGTGAGTCTCAAGGACAGGGTGGTGAAGCGGGGAGAGCACGTCGAGGTCACCGGGCTACGAAGCTCACA
GGCTGACGTCGAGGTGAGCTTTGAGGTGCCGAGCTTGGAGGGAGCGGAGGCGTTGGACCCAGCGCTAGCCAACGACGCCCAGAAGCTGTGCAGCGTGAGG
GGTGCCGACGTGGAAGGCGGCGTGGGCCCCTTTGGTCTGTGGGTGCTCGCCTCGTCCAAGCTGGAGGAGAAGACGGCGGTCTTCTTCCGGGTGTTCAAGG
CCGCGCGCAACATCAACAGCACCAAGCCGGTGGTCCTCATGTGCTCCGACCCCACCACGTCATCTTTGAACCCGAACCTCTACAAGCCGACGTTCGCAGG
CTTTGTTGATACTGACATAGCGAAGGGCAAGATATCTCTGAGGAGCCTGATTGATCGGTCCGTGGTCGAGAGCTTCGGGGCAGGAGGCAGGACCTGCATC
CTCTCCCGGGTCTATCCGACCCTCGCCCTAGGCAAGAACGCTCACCTTCACGTTTTCAACAACGGCAAGGTGGACATCAAGGTGTCACAGCTCACGGCGT
GGGAGATGAAGAAGCCAGCGCTCATGAACGGTGCTTAGAATTTAAGGTGGATCTACATGCAGGCTTCCTATATATGTGCCTGAATTTGGCTCATATTCTG
TTAAATTGATCTCTAGTGAAACGTGATAGTTCTACGTGGGTACGTACGTAGCTAGGTTTGCACGTAGTATAAGTGCACTACGAAGGGATCATTTTGCCCG
TAGGAATAATAAAAGTTCTATGCATACTCTGCCGTGCACATTGGTGGAAAGT
page-top